CNRS Nantes University UFIP UFIP
home |  start a new run |  job status |  references&downloads |  examples |  help  

Elnemo is running on a new server.
Should you encounter any unexpected behaviour,
please let us know.


***  STRUCTURAL PROTEIN/DNA 31-JAN-02 1KX5  ***

elNémo ID: 19020109545141367

Job options:

ID        	=	 19020109545141367
JOBID     	=	 STRUCTURAL PROTEIN/DNA 31-JAN-02 1KX5
USERID    	=	 unknown
PRIVAT    	=	 0

NMODES    	=	 25
DQMIN     	=	 -100
DQMAX     	=	 100
DQSTEP    	=	 20
DOGRAPHS  	=	 on

DOPROJMODS	=	 0
DORMSD    	=	 0

NRBL      	=	 0
CUTOFF    	=	 0
CAONLY    	=	 0


Input data for this run:


HEADER    STRUCTURAL PROTEIN/DNA                  31-JAN-02   1KX5              
TITLE     X-RAY STRUCTURE OF THE NUCLEOSOME CORE PARTICLE, NCP147, AT           
TITLE    2 1.9 A RESOLUTION                                                     
COMPND    MOL_ID: 1;                                                            
COMPND   2 MOLECULE: DNA                                                        
COMPND   3 (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAA          
COMPND   4 AAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATA          
COMPND   5 CACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3');                               
COMPND   6 CHAIN: I;                                                            
COMPND   7 ENGINEERED: YES;                                                     
COMPND   8 OTHER_DETAILS: PALINDROMIC 147 BASE PAIR DNA DUPLEX WITH             
COMPND   9 EXCEPTION OF POSITION 0;                                             
COMPND  10 MOL_ID: 2;                                                           
COMPND  11 MOLECULE: DNA                                                        
COMPND  12 (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAA          
COMPND  13 AAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATA          
COMPND  14 CACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3');                               
COMPND  15 CHAIN: J;                                                            
COMPND  16 ENGINEERED: YES;                                                     
COMPND  17 OTHER_DETAILS: PALINDROMIC 147 BASE PAIR DNA DUPLEX WITH             
COMPND  18 EXCEPTION OF POSITION 0;                                             
COMPND  19 MOL_ID: 3;                                                           
COMPND  20 MOLECULE: HISTONE H3;                                                
COMPND  21 CHAIN: A, E;                                                         
COMPND  22 ENGINEERED: YES;                                                     
COMPND  23 MOL_ID: 4;                                                           
COMPND  24 MOLECULE: HISTONE H4;                                                
COMPND  25 CHAIN: B, F;                                                         
COMPND  26 ENGINEERED: YES;                                                     
COMPND  27 MOL_ID: 5;                                                           
COMPND  28 MOLECULE: HISTONE H2A.1;                                             
COMPND  29 CHAIN: C, G;                                                         
COMPND  30 ENGINEERED: YES;                                                     
COMPND  31 MOL_ID: 6;                                                           
COMPND  32 MOLECULE: HISTONE H2B.2;                                             
COMPND  33 CHAIN: D, H;                                                         
COMPND  34 ENGINEERED: YES                                                      
SOURCE    MOL_ID: 1;                                                            
SOURCE   2 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE   3 ORGANISM_COMMON: HUMAN;                                              
SOURCE   4 ORGANISM_TAXID: 9606;                                                
SOURCE   5 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE   6 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE   7 OTHER_DETAILS: DNA SEQUENCE SYNTHESIZED, CLONED,                     
SOURCE   8 MULTIMERIZED, AND EXCISED FROM PLASMID;                              
SOURCE   9 MOL_ID: 2;                                                           
SOURCE  10 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE  11 ORGANISM_COMMON: HUMAN;                                              
SOURCE  12 ORGANISM_TAXID: 9606;                                                
SOURCE  13 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  14 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  15 OTHER_DETAILS: DNA SEQUENCE SYNTHESIZED, CLONED,                     
SOURCE  16 MULTIMERIZED, AND EXCISED FROM PLASMID;                              
SOURCE  17 MOL_ID: 3;                                                           
SOURCE  18 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  19 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  20 ORGANISM_TAXID: 8355;                                                
SOURCE  21 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  22 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  23 MOL_ID: 4;                                                           
SOURCE  24 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  25 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  26 ORGANISM_TAXID: 8355;                                                
SOURCE  27 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  28 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  29 MOL_ID: 5;                                                           
SOURCE  30 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  31 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  32 ORGANISM_TAXID: 8355;                                                
SOURCE  33 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  34 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  35 MOL_ID: 6;                                                           
SOURCE  36 ORGANISM_SCIENTIFIC: XENOPUS LAEVIS;                                 
SOURCE  37 ORGANISM_COMMON: AFRICAN CLAWED FROG;                                
SOURCE  38 ORGANISM_TAXID: 8355;                                                
SOURCE  39 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  40 EXPRESSION_SYSTEM_TAXID: 562                                         
KEYWDS    NUCLEOSOME, CHROMATIN, HISTONE, PROTEIN-DNA INTERACTION,              
KEYWDS   2 NUCLEOPROTEIN, SUPERCOILED DNA, NUCLEOSOME CORE, PROTEIN-            
KEYWDS   3 DNA COMPLEX, DNA BENDING, DNA CURVATURE, DNA-CATION BINDING,         
KEYWDS   4 DNA-METAL BINDING, DNA SOLVATION, STRUCTURAL PROTEIN/DNA             
KEYWDS   5 COMPLEX                                                              
EXPDTA    X-RAY DIFFRACTION                                                     
AUTHOR    C.A.DAVEY,D.F.SARGENT,K.LUGER,A.W.MAEDER,T.J.RICHMOND                 
REVDAT   2   24-FEB-09 1KX5    1       VERSN                                    
REVDAT   1   25-DEC-02 1KX5    0                                                
JRNL        AUTH   C.A.DAVEY,D.F.SARGENT,K.LUGER,A.W.MAEDER,                    
JRNL        AUTH 2 T.J.RICHMOND                                                 
JRNL        TITL   SOLVENT MEDIATED INTERACTIONS IN THE STRUCTURE OF            
JRNL        TITL 2 THE NUCLEOSOME CORE PARTICLE AT 1.9 A RESOLUTION             
JRNL        REF    J.MOL.BIOL.                   V. 319  1097 2002              
JRNL        REFN                   ISSN 0022-2836                               
JRNL        PMID   12079350                                                     
JRNL        DOI    10.1016/S0022-2836(02)00386-8                                
REMARK   1                                                                      
REMARK   1 REFERENCE 1                                                          
REMARK   1  AUTH   K.LUGER,A.W.MAEDER,R.K.RICHMOND,D.F.SARGENT,                 
REMARK   1  AUTH 2 T.J.RICHMOND                                                 
REMARK   1  TITL   CRYSTAL STRUCTURE OF THE NUCLEOSOME CORE PARTICLE            
REMARK   1  TITL 2 AT 2.8 A RESOLUTION                                          
REMARK   1  REF    NATURE                        V. 389   251 1997              
REMARK   1  REFN                   ISSN 0028-0836                               
REMARK   1  DOI    10.1038/38444                                                
REMARK   1 REFERENCE 2                                                          
REMARK   1  AUTH   C.A.DAVEY,T.J.RICHMOND                                       
REMARK   1  TITL   DNA-DEPENDENT DIVALENT CATION BINDING IN THE                 
REMARK   1  TITL 2 NUCLEOSOME CORE PARTICLE.                                    
REMARK   1  REF    PROC.NATL.ACAD.SCI.USA        V.  99 11169 2002              
REMARK   1  REFN                   ISSN 0027-8424                               
REMARK   1  DOI    10.1073/PNAS.172271399                                       
REMARK   1 REFERENCE 3                                                          
REMARK   1  AUTH   T.J.RICHMOND,C.A.DAVEY                                       
REMARK   1  TITL   DNA STRUCTURE IN THE NUCLEOSOME CORE                         
REMARK   1  REF    TO BE PUBLISHED                                              
REMARK   1  REFN                                                                
REMARK   2                                                                      
REMARK   2 RESOLUTION.    1.94 ANGSTROMS.                                       
REMARK   3                                                                      
REMARK   3 REFINEMENT.                                                          
REMARK   3   PROGRAM     : CNS 0.5                                              
REMARK   3   AUTHORS     : BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE-              
REMARK   3               : KUNSTLEVE,JIANG,KUSZEWSKI,NILGES, PANNU,             
REMARK   3               : READ,RICE,SIMONSON,WARREN                            
REMARK   3                                                                      
REMARK   3  REFINEMENT TARGET : ENGH & HUBER                                    
REMARK   3                                                                      
REMARK   3  DATA USED IN REFINEMENT.                                            
REMARK   3   RESOLUTION RANGE HIGH (ANGSTROMS) : 1.94                           
REMARK   3   RESOLUTION RANGE LOW  (ANGSTROMS) : 6.00                           
REMARK   3   DATA CUTOFF            (SIGMA(F)) : 0.000                          
REMARK   3   DATA CUTOFF HIGH         (ABS(F)) : 2948930.380                    
REMARK   3   DATA CUTOFF LOW          (ABS(F)) : 0.0000                         
REMARK   3   COMPLETENESS (WORKING+TEST)   (%) : 95.6                           
REMARK   3   NUMBER OF REFLECTIONS             : 143936                         
REMARK   3                                                                      
REMARK   3  FIT TO DATA USED IN REFINEMENT.                                     
REMARK   3   CROSS-VALIDATION METHOD          : THROUGHOUT                      
REMARK   3   FREE R VALUE TEST SET SELECTION  : RANDOM                          
REMARK   3   R VALUE            (WORKING SET) : 0.208                           
REMARK   3   FREE R VALUE                     : 0.275                           
REMARK   3   FREE R VALUE TEST SET SIZE   (%) : 2.000                           
REMARK   3   FREE R VALUE TEST SET COUNT      : 2898                            
REMARK   3   ESTIMATED ERROR OF FREE R VALUE  : 0.005                           
REMARK   3                                                                      
REMARK   3  FIT IN THE HIGHEST RESOLUTION BIN.                                  
REMARK   3   TOTAL NUMBER OF BINS USED           : 6                            
REMARK   3   BIN RESOLUTION RANGE HIGH       (A) : 1.94                         
REMARK   3   BIN RESOLUTION RANGE LOW        (A) : 2.06                         
REMARK   3   BIN COMPLETENESS (WORKING+TEST) (%) : 88.10                        
REMARK   3   REFLECTIONS IN BIN    (WORKING SET) : 21475                        
REMARK   3   BIN R VALUE           (WORKING SET) : 0.3150                       
REMARK   3   BIN FREE R VALUE                    : 0.3510                       
REMARK   3   BIN FREE R VALUE TEST SET SIZE  (%) : 2.10                         
REMARK   3   BIN FREE R VALUE TEST SET COUNT     : 452                          
REMARK   3   ESTIMATED ERROR OF BIN FREE R VALUE : 0.016                        
REMARK   3                                                                      
REMARK   3  NUMBER OF NON-HYDROGEN ATOMS USED IN REFINEMENT.                    
REMARK   3   PROTEIN ATOMS            : 7586                                    
REMARK   3   NUCLEIC ACID ATOMS       : 6021                                    
REMARK   3   HETEROGEN ATOMS          : 18                                      
REMARK   3   SOLVENT ATOMS            : 3130                                    
REMARK   3                                                                      
REMARK   3  B VALUES.                                                           
REMARK   3   FROM WILSON PLOT           (A**2) : 35.10                          
REMARK   3   MEAN B VALUE      (OVERALL, A**2) : 51.50                          
REMARK   3   OVERALL ANISOTROPIC B VALUE.                                       
REMARK   3    B11 (A**2) : 2.61000                                              
REMARK   3    B22 (A**2) : 3.30000                                              
REMARK   3    B33 (A**2) : -5.91000                                             
REMARK   3    B12 (A**2) : 0.00000                                              
REMARK   3    B13 (A**2) : 0.00000                                              
REMARK   3    B23 (A**2) : 0.00000                                              
REMARK   3                                                                      
REMARK   3  ESTIMATED COORDINATE ERROR.                                         
REMARK   3   ESD FROM LUZZATI PLOT        (A) : 0.23                            
REMARK   3   ESD FROM SIGMAA              (A) : 0.18                            
REMARK   3   LOW RESOLUTION CUTOFF        (A) : 6.00                            
REMARK   3                                                                      
REMARK   3  CROSS-VALIDATED ESTIMATED COORDINATE ERROR.                         
REMARK   3   ESD FROM C-V LUZZATI PLOT    (A) : 0.30                            
REMARK   3   ESD FROM C-V SIGMAA          (A) : 0.16                            
REMARK   3                                                                      
REMARK   3  RMS DEVIATIONS FROM IDEAL VALUES.                                   
REMARK   3   BOND LENGTHS                 (A) : 0.009                           
REMARK   3   BOND ANGLES            (DEGREES) : 1.20                            
REMARK   3   DIHEDRAL ANGLES        (DEGREES) : 19.20                           
REMARK   3   IMPROPER ANGLES        (DEGREES) : 1.22                            
REMARK   3                                                                      
REMARK   3  ISOTROPIC THERMAL MODEL : RESTRAINED                                
REMARK   3                                                                      
REMARK   3  ISOTROPIC THERMAL FACTOR RESTRAINTS.    RMS    SIGMA                
REMARK   3   MAIN-CHAIN BOND              (A**2) : 2.120 ; 1.500                
REMARK   3   MAIN-CHAIN ANGLE             (A**2) : 2.840 ; 2.000                
REMARK   3   SIDE-CHAIN BOND              (A**2) : 2.730 ; 2.000                
REMARK   3   SIDE-CHAIN ANGLE             (A**2) : 3.810 ; 2.500                
REMARK   3                                                                      
REMARK   3  BULK SOLVENT MODELING.                                              
REMARK   3   METHOD USED : NULL                                                 
REMARK   3   KSOL        : NULL                                                 
REMARK   3   BSOL        : NULL                                                 
REMARK   3                                                                      
REMARK   3  NCS MODEL : NULL                                                    
REMARK   3                                                                      
REMARK   3  NCS RESTRAINTS.                         RMS   SIGMA/WEIGHT          
REMARK   3   GROUP  1  POSITIONAL            (A) : NULL  ; NULL                 
REMARK   3   GROUP  1  B-FACTOR           (A**2) : NULL  ; NULL                 
REMARK   3                                                                      
REMARK   3  PARAMETER FILE  1  : PROTEIN_REP.PARAM                              
REMARK   3  PARAMETER FILE  2  : DNA-RNA_REP.PARAM                              
REMARK   3  PARAMETER FILE  3  : WATER_REP.PARAM                                
REMARK   3  PARAMETER FILE  4  : ION.PARAM                                      
REMARK   3  PARAMETER FILE  5  : NULL                                           
REMARK   3  TOPOLOGY FILE  1   : PROTEIN.TOP                                    
REMARK   3  TOPOLOGY FILE  2   : DNA-RNA.TOP                                    
REMARK   3  TOPOLOGY FILE  3   : WATER.TOP                                      
REMARK   3  TOPOLOGY FILE  4   : ION.TOP                                        
REMARK   3  TOPOLOGY FILE  5   : NULL                                           
REMARK   3                                                                      
REMARK   3  OTHER REFINEMENT REMARKS: 792 OF THE PROTEIN ATOMS HAVE ZERO        
REMARK   3  OCCUPANCY. THESE INCLUDE DISORDERED PORTIONS OF THE N-TERMINAL      
REMARK   3  TAIL REGIONS OF CHAINS A-H AND THE C-TERMINUS OF CHAINS C & G.      
REMARK   3  THE AMINO ACIDS WITH ZERO OCCUPANCY ARE WITHIN RESIDUES 1-32        
REMARK   3  OF CHAIN A, 1-30 OF CHAIN E, 1-23 OF CHAIN B, 1-15 OF CHAIN F,      
REMARK   3  1-14 & 121-128 OF CHAIN C, 1-12 & 122-128 OF CHAIN G, 1-21 OF       
REMARK   3  CHAIN D, AND 1-23 OF CHAIN H. THEY WERE INCLUDED IN THE             
REMARK   3  REFINEMENT FOR STEREOCHEMICAL PURPOSES, BUT DID NOT CONTRIBUTE      
REMARK   3  TO THE X-RAY TERM.                                                  
REMARK   4                                                                      
REMARK   4 1KX5 COMPLIES WITH FORMAT V. 3.15, 01-DEC-08                         
REMARK 100                                                                      
REMARK 100 THIS ENTRY HAS BEEN PROCESSED BY RCSB ON 11-FEB-02.                  
REMARK 100 THE RCSB ID CODE IS RCSB015431.                                      
REMARK 200                                                                      
REMARK 200 EXPERIMENTAL DETAILS                                                 
REMARK 200  EXPERIMENT TYPE                : X-RAY DIFFRACTION                  
REMARK 200  DATE OF DATA COLLECTION        : 18-MAY-99                          
REMARK 200  TEMPERATURE           (KELVIN) : 103                                
REMARK 200  PH                             : 6.0                                
REMARK 200  NUMBER OF CRYSTALS USED        : 44                                 
REMARK 200                                                                      
REMARK 200  SYNCHROTRON              (Y/N) : Y                                  
REMARK 200  RADIATION SOURCE               : ESRF                               
REMARK 200  BEAMLINE                       : ID14-4                             
REMARK 200  X-RAY GENERATOR MODEL          : NULL                               
REMARK 200  MONOCHROMATIC OR LAUE    (M/L) : M                                  
REMARK 200  WAVELENGTH OR RANGE        (A) : 0.93                               
REMARK 200  MONOCHROMATOR                  : SI 111 CHANNEL                     
REMARK 200  OPTICS                         : NULL                               
REMARK 200                                                                      
REMARK 200  DETECTOR TYPE                  : IMAGE PLATE                        
REMARK 200  DETECTOR MANUFACTURER          : MARRESEARCH                        
REMARK 200  INTENSITY-INTEGRATION SOFTWARE : DENZO                              
REMARK 200  DATA SCALING SOFTWARE          : SCALEPACK                          
REMARK 200                                                                      
REMARK 200  NUMBER OF UNIQUE REFLECTIONS   : 151140                             
REMARK 200  RESOLUTION RANGE HIGH      (A) : 1.940                              
REMARK 200  RESOLUTION RANGE LOW       (A) : 20.000                             
REMARK 200  REJECTION CRITERIA  (SIGMA(I)) : 1.000                              
REMARK 200                                                                      
REMARK 200 OVERALL.                                                             
REMARK 200  COMPLETENESS FOR RANGE     (%) : 95.6                               
REMARK 200  DATA REDUNDANCY                : 5.100                              
REMARK 200  R MERGE                    (I) : 0.07200                            
REMARK 200  R SYM                      (I) : NULL                               
REMARK 200   FOR THE DATA SET  : NULL                               
REMARK 200                                                                      
REMARK 200 IN THE HIGHEST RESOLUTION SHELL.                                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE HIGH (A) : 1.94                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE LOW  (A) : 2.01                     
REMARK 200  COMPLETENESS FOR SHELL     (%) : 88.0                               
REMARK 200  DATA REDUNDANCY IN SHELL       : NULL                               
REMARK 200  R MERGE FOR SHELL          (I) : 0.29100                            
REMARK 200  R SYM FOR SHELL            (I) : NULL                               
REMARK 200   FOR SHELL         : NULL                               
REMARK 200                                                                      
REMARK 200 DIFFRACTION PROTOCOL: SINGLE WAVELENGTH                              
REMARK 200 METHOD USED TO DETERMINE THE STRUCTURE: FOURIER SYNTHESIS            
REMARK 200 SOFTWARE USED: CNS                                                   
REMARK 200 STARTING MODEL: PDB ENTRY 1AOI                                       
REMARK 200                                                                      
REMARK 200 REMARK: NULL                                                         
REMARK 280                                                                      
REMARK 280 CRYSTAL                                                              
REMARK 280 SOLVENT CONTENT, VS   (%): 52.54                                     
REMARK 280 MATTHEWS COEFFICIENT, VM (ANGSTROMS**3/DA): 2.59                     
REMARK 280                                                                      
REMARK 280 CRYSTALLIZATION CONDITIONS: MANGANESE CHLORIDE, POTASSIUM            
REMARK 280  CHLORIDE, POTASSIUM CACODYLATE, PH 6.0, VAPOR DIFFUSION,            
REMARK 280  SITTING DROP, TEMPERATURE 293K                                      
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY                                            
REMARK 290 SYMMETRY OPERATORS FOR SPACE GROUP: P 21 21 21                       
REMARK 290                                                                      
REMARK 290      SYMOP   SYMMETRY                                                
REMARK 290     NNNMMM   OPERATOR                                                
REMARK 290       1555   X,Y,Z                                                   
REMARK 290       2555   -X+1/2,-Y,Z+1/2                                         
REMARK 290       3555   -X,Y+1/2,-Z+1/2                                         
REMARK 290       4555   X+1/2,-Y+1/2,-Z                                         
REMARK 290                                                                      
REMARK 290     WHERE NNN -> OPERATOR NUMBER                                     
REMARK 290           MMM -> TRANSLATION VECTOR                                  
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY TRANSFORMATIONS                            
REMARK 290 THE FOLLOWING TRANSFORMATIONS OPERATE ON THE ATOM/HETATM             
REMARK 290 RECORDS IN THIS ENTRY TO PRODUCE CRYSTALLOGRAPHICALLY                
REMARK 290 RELATED MOLECULES.                                                   
REMARK 290   SMTRY1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 290   SMTRY1   2 -1.000000  0.000000  0.000000       52.97500            
REMARK 290   SMTRY2   2  0.000000 -1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   2  0.000000  0.000000  1.000000       54.74500            
REMARK 290   SMTRY1   3 -1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   3  0.000000  1.000000  0.000000       90.58500            
REMARK 290   SMTRY3   3  0.000000  0.000000 -1.000000       54.74500            
REMARK 290   SMTRY1   4  1.000000  0.000000  0.000000       52.97500            
REMARK 290   SMTRY2   4  0.000000 -1.000000  0.000000       90.58500            
REMARK 290   SMTRY3   4  0.000000  0.000000 -1.000000        0.00000            
REMARK 290                                                                      
REMARK 290 REMARK: NULL                                                         
REMARK 300                                                                      
REMARK 300 BIOMOLECULE: 1                                                       
REMARK 300 SEE REMARK 350 FOR THE AUTHOR PROVIDED AND/OR PROGRAM                
REMARK 300 GENERATED ASSEMBLY INFORMATION FOR THE STRUCTURE IN                  
REMARK 300 THIS ENTRY. THE REMARK MAY ALSO PROVIDE INFORMATION ON               
REMARK 300 BURIED SURFACE AREA.                                                 
REMARK 350                                                                      
REMARK 350 COORDINATES FOR A COMPLETE MULTIMER REPRESENTING THE KNOWN           
REMARK 350 BIOLOGICALLY SIGNIFICANT OLIGOMERIZATION STATE OF THE                
REMARK 350 MOLECULE CAN BE GENERATED BY APPLYING BIOMT TRANSFORMATIONS          
REMARK 350 GIVEN BELOW.  BOTH NON-CRYSTALLOGRAPHIC AND                          
REMARK 350 CRYSTALLOGRAPHIC OPERATIONS ARE GIVEN.                               
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 1                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: DECAMERIC                         
REMARK 350 APPLY THE FOLLOWING TO CHAINS: I, J, A, B, C, D, E, F, G, H          
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 465                                                                      
REMARK 465 MISSING RESIDUES                                                     
REMARK 465 THE FOLLOWING RESIDUES WERE NOT LOCATED IN THE                       
REMARK 465 EXPERIMENT. (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 465 IDENTIFIER; SSSEQ=SEQUENCE NUMBER; I=INSERTION CODE.)                
REMARK 465                                                                      
REMARK 465   M RES C SSSEQI                                                     
REMARK 465     PRO D    -2                                                      
REMARK 465     GLU D    -1                                                      
REMARK 465     PRO D     0                                                      
REMARK 465     PRO H    -2                                                      
REMARK 465     GLU H    -1                                                      
REMARK 465     PRO H     0                                                      
REMARK 475                                                                      
REMARK 475 ZERO OCCUPANCY RESIDUES                                              
REMARK 475 THE FOLLOWING RESIDUES WERE MODELED WITH ZERO OCCUPANCY.             
REMARK 475 THE LOCATION AND PROPERTIES OF THESE RESIDUES MAY NOT                
REMARK 475 BE RELIABLE. (M=MODEL NUMBER; RES=RESIDUE NAME;                      
REMARK 475 C=CHAIN IDENTIFIER; SSEQ=SEQUENCE NUMBER; I=INSERTION CODE)          
REMARK 475   M RES C SSEQI                                                      
REMARK 475     LYS A    4                                                       
REMARK 475     LYS A    9                                                       
REMARK 475     SER A   10                                                       
REMARK 475     LYS A   14                                                       
REMARK 475     ALA A   15                                                       
REMARK 475     PRO A   16                                                       
REMARK 475     GLN A   19                                                       
REMARK 475     LEU A   20                                                       
REMARK 475     ALA A   21                                                       
REMARK 475     THR A   22                                                       
REMARK 475     LYS A   23                                                       
REMARK 475     ALA A   24                                                       
REMARK 475     ALA A   25                                                       
REMARK 475     ARG A   26                                                       
REMARK 475     SER A   28                                                       
REMARK 475     ALA A   29                                                       
REMARK 475     PRO A   30                                                       
REMARK 475     ALA A   31                                                       
REMARK 475     THR A   32                                                       
REMARK 475     SER B    1                                                       
REMARK 475     GLY B    2                                                       
REMARK 475     ARG B    3                                                       
REMARK 475     LYS B    8                                                       
REMARK 475     GLY B    9                                                       
REMARK 475     LEU B   10                                                       
REMARK 475     GLY B   13                                                       
REMARK 475     GLY B   14                                                       
REMARK 475     ALA B   15                                                       
REMARK 475     LEU B   22                                                       
REMARK 475     ARG B   23                                                       
REMARK 475     GLY C    4                                                       
REMARK 475     LYS C    5                                                       
REMARK 475     GLN C    6                                                       
REMARK 475     GLY C    7                                                       
REMARK 475     GLY C    8                                                       
REMARK 475     LYS C    9                                                       
REMARK 475     LYS C   13                                                       
REMARK 475     ALA C   14                                                       
REMARK 475     GLU C  121                                                       
REMARK 475     SER C  123                                                       
REMARK 475     LYS C  124                                                       
REMARK 475     SER C  125                                                       
REMARK 475     LYS C  126                                                       
REMARK 475     SER C  127                                                       
REMARK 475     ALA D    1                                                       
REMARK 475     LYS D    2                                                       
REMARK 475     SER D    3                                                       
REMARK 475     ALA D    4                                                       
REMARK 475     PRO D    5                                                       
REMARK 475     ALA D    6                                                       
REMARK 475     PRO D    7                                                       
REMARK 475     ALA D   14                                                       
REMARK 475     VAL D   15                                                       
REMARK 475     THR D   16                                                       
REMARK 475     LYS D   17                                                       
REMARK 475     THR D   18                                                       
REMARK 475     GLN D   19                                                       
REMARK 475     LYS D   20                                                       
REMARK 475     LYS D   21                                                       
REMARK 475     LYS E    4                                                       
REMARK 475     GLN E    5                                                       
REMARK 475     ALA E    7                                                       
REMARK 475     LYS E   14                                                       
REMARK 475     ALA E   15                                                       
REMARK 475     GLN E   19                                                       
REMARK 475     ALA E   24                                                       
REMARK 475     ALA E   25                                                       
REMARK 475     ARG E   26                                                       
REMARK 475     LYS E   27                                                       
REMARK 475     SER E   28                                                       
REMARK 475     ALA E   29                                                       
REMARK 475     PRO E   30                                                       
REMARK 475     GLY F    6                                                       
REMARK 475     GLY F    7                                                       
REMARK 475     LYS F    8                                                       
REMARK 475     GLY F    9                                                       
REMARK 475     LEU F   10                                                       
REMARK 475     GLY F   13                                                       
REMARK 475     GLY F   14                                                       
REMARK 475     ALA F   15                                                       
REMARK 475     SER G    1                                                       
REMARK 475     GLY G    2                                                       
REMARK 475     ARG G    3                                                       
REMARK 475     LYS G    9                                                       
REMARK 475     THR G   10                                                       
REMARK 475     ARG G   11                                                       
REMARK 475     ALA G   12                                                       
REMARK 475     SER G  122                                                       
REMARK 475     SER G  123                                                       
REMARK 475     LYS G  124                                                       
REMARK 475     SER G  125                                                       
REMARK 475     LYS G  126                                                       
REMARK 475     SER G  127                                                       
REMARK 475     LYS G  128                                                       
REMARK 475     ALA H    1                                                       
REMARK 475     LYS H    2                                                       
REMARK 475     SER H    3                                                       
REMARK 475     ALA H    4                                                       
REMARK 475     PRO H    5                                                       
REMARK 475     ALA H    6                                                       
REMARK 475     PRO H    7                                                       
REMARK 475     LYS H    8                                                       
REMARK 475     LYS H    9                                                       
REMARK 475     GLY H   10                                                       
REMARK 475     SER H   11                                                       
REMARK 475     LYS H   12                                                       
REMARK 475     LYS H   13                                                       
REMARK 475     ALA H   14                                                       
REMARK 475     VAL H   15                                                       
REMARK 475     THR H   16                                                       
REMARK 475     LYS H   17                                                       
REMARK 475     LYS H   21                                                       
REMARK 475     ASP H   22                                                       
REMARK 475     GLY H   23                                                       
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: CLOSE CONTACTS IN SAME ASYMMETRIC UNIT                     
REMARK 500                                                                      
REMARK 500 THE FOLLOWING ATOMS ARE IN CLOSE CONTACT.                            
REMARK 500                                                                      
REMARK 500  ATM1  RES C  SSEQI   ATM2  RES C  SSEQI           DISTANCE          
REMARK 500   OE1  GLU C    92     O    HOH C   207              2.15            
REMARK 500   OP2  DG  I    -2     O    HOH I  3267              2.16            
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: COVALENT BOND ANGLES                                       
REMARK 500                                                                      
REMARK 500 THE STEREOCHEMICAL PARAMETERS OF THE FOLLOWING RESIDUES              
REMARK 500 HAVE VALUES WHICH DEVIATE FROM EXPECTED VALUES BY MORE               
REMARK 500 THAN 6*RMSD (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 500 IDENTIFIER; SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                 
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT: (10X,I3,1X,A3,1X,A1,I4,A1,3(1X,A4,2X),12X,F5.1)              
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES PROTEIN: ENGH AND HUBER, 1999                        
REMARK 500 EXPECTED VALUES NUCLEIC ACID: CLOWNEY ET AL 1996                     
REMARK 500                                                                      
REMARK 500  M RES CSSEQI ATM1   ATM2   ATM3                                     
REMARK 500     DT I  67   C3' -  C2' -  C1' ANGL. DEV. =  -4.9 DEGREES          
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: TORSION ANGLES                                             
REMARK 500                                                                      
REMARK 500 TORSION ANGLES OUTSIDE THE EXPECTED RAMACHANDRAN REGIONS:            
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT:(10X,I3,1X,A3,1X,A1,I4,A1,4X,F7.2,3X,F7.2)                    
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES: GJ KLEYWEGT AND TA JONES (1996). PHI/PSI-           
REMARK 500 CHOLOGY: RAMACHANDRAN REVISITED. STRUCTURE 4, 1395 - 1400            
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        PSI       PHI                                   
REMARK 500    ARG A   2     -114.81    168.92                                   
REMARK 500    THR A   3      -22.72    159.60                                   
REMARK 500    LYS A   4     -140.18    -66.73                                   
REMARK 500    GLN A   5      -74.65     62.00                                   
REMARK 500    THR A   6      -77.79    -81.97                                   
REMARK 500    ALA A   7       15.81     53.39                                   
REMARK 500    LYS A   9     -145.54     35.47                                   
REMARK 500    ARG A  17     -171.82     70.54                                   
REMARK 500    LYS A  18       54.46    -67.13                                   
REMARK 500    GLN A  19       96.77    174.68                                   
REMARK 500    LEU A  20      175.95     50.82                                   
REMARK 500    ALA A  21      133.94     61.66                                   
REMARK 500    THR A  22       67.44   -150.65                                   
REMARK 500    ALA A  24       34.87    -92.87                                   
REMARK 500    ARG A  26      -59.76   -152.99                                   
REMARK 500    LYS A  27       52.81   -179.21                                   
REMARK 500    SER A  28      -99.13   -144.49                                   
REMARK 500    ALA A  31     -145.99    -87.14                                   
REMARK 500    VAL A  35      -38.49   -171.44                                   
REMARK 500    LYS A  36       54.46     90.32                                   
REMARK 500    LYS A  37       77.90     66.23                                   
REMARK 500    ARG B   3      158.35     59.23                                   
REMARK 500    LYS B   5       11.23   -167.72                                   
REMARK 500    LYS B   8     -157.47     54.72                                   
REMARK 500    ARG B  17       72.01   -163.39                                   
REMARK 500    LYS B  20     -135.22     74.44                                   
REMARK 500    LEU B  22       84.17     84.77                                   
REMARK 500    ARG B  23     -121.49   -159.74                                   
REMARK 500    ASP B  24      -85.03    -49.56                                   
REMARK 500    ASN B  25      -93.63     61.67                                   
REMARK 500    ARG C   3     -105.24     59.53                                   
REMARK 500    ALA C  12      -77.53   -178.68                                   
REMARK 500    LYS C  13      -53.19     72.61                                   
REMARK 500    ASN C 110      110.03   -165.96                                   
REMARK 500    LYS C 118     -171.24    160.16                                   
REMARK 500    THR C 120       -0.57     55.69                                   
REMARK 500    SER C 123     -142.71     31.81                                   
REMARK 500    LYS C 126       74.25     65.94                                   
REMARK 500    SER C 127     -144.64   -161.40                                   
REMARK 500    SER D   3      -62.31   -107.77                                   
REMARK 500    PRO D   5      -98.37    -80.74                                   
REMARK 500    PRO D   7     -124.33    -83.15                                   
REMARK 500    LYS D   8      -51.34     76.11                                   
REMARK 500    LYS D   9       96.49    -20.25                                   
REMARK 500    SER D  11     -140.35    -84.24                                   
REMARK 500    LYS D  12      125.48     67.29                                   
REMARK 500    LYS D  13       91.84     55.20                                   
REMARK 500    VAL D  15      -78.72     71.00                                   
REMARK 500    THR D  16      -99.34   -160.45                                   
REMARK 500    LYS D  17       95.58     31.20                                   
REMARK 500    GLN D  19      -80.81    -83.05                                   
REMARK 500    LYS D  21      120.29     64.46                                   
REMARK 500    LYS D  24       67.43     64.16                                   
REMARK 500    ARG D  26       84.56     29.58                                   
REMARK 500    ARG D  27      119.50    -14.03                                   
REMARK 500    THR E   3        0.55     58.40                                   
REMARK 500    LYS E   4     -136.17    -92.78                                   
REMARK 500    THR E   6      -42.41   -145.81                                   
REMARK 500    ALA E   7       30.99     71.42                                   
REMARK 500    SER E  10     -120.73     72.99                                   
REMARK 500    THR E  11       77.16     -4.83                                   
REMARK 500    LYS E  14      -88.96     20.11                                   
REMARK 500    ARG E  17       -6.47   -169.70                                   
REMARK 500    GLN E  19       42.01    154.77                                   
REMARK 500    LEU E  20     -161.68    -53.82                                   
REMARK 500    ALA E  21      173.86     38.50                                   
REMARK 500    ALA E  25       67.33     82.09                                   
REMARK 500    ARG E  26      -66.36   -120.26                                   
REMARK 500    SER E  28      -71.88    176.12                                   
REMARK 500    ALA E  29       59.15     37.28                                   
REMARK 500    PRO E  30       88.05    -53.37                                   
REMARK 500    THR E  32      115.90     86.98                                   
REMARK 500    VAL E  35     -152.33     50.79                                   
REMARK 500    LYS E  36     -140.00    -94.57                                   
REMARK 500    LYS E  37      -28.74   -153.57                                   
REMARK 500    PRO E  38      134.34    -27.56                                   
REMARK 500    LYS F   5      -85.96   -178.91                                   
REMARK 500    LYS F  12     -107.73   -128.35                                   
REMARK 500    ALA F  15       92.06     58.34                                   
REMARK 500    LYS F  16      -14.72   -159.20                                   
REMARK 500    HIS F  18     -148.34    -71.88                                   
REMARK 500    ARG F  19       80.06     88.69                                   
REMARK 500    ARG G   3      -95.43     57.30                                   
REMARK 500    LYS G   5      -13.88     75.05                                   
REMARK 500    GLN G   6       -5.13     73.35                                   
REMARK 500    LYS G   9      162.91    -46.30                                   
REMARK 500    ARG G  11        5.03    -66.32                                   
REMARK 500    LYS G  13       84.99    -61.97                                   
REMARK 500    ALA G  14      -90.21    -47.86                                   
REMARK 500    PRO G  26       97.73    -67.54                                   
REMARK 500    ASN G 110      114.23   -168.08                                   
REMARK 500    LYS G 118       78.40     75.96                                   
REMARK 500    LYS G 119      -73.14     57.13                                   
REMARK 500    THR G 120      105.57   -172.21                                   
REMARK 500    GLU G 121       94.92   -169.24                                   
REMARK 500    SER G 123     -140.48     58.67                                   
REMARK 500    LYS G 124      142.91     64.14                                   
REMARK 500    SER G 125      -11.78   -140.62                                   
REMARK 500    LYS G 126      -70.22    -62.78                                   
REMARK 500    PRO H   7     -170.98    -69.51                                   
REMARK 500    LYS H   8       70.23   -115.69                                   
REMARK 500    VAL H  15      -96.72     55.89                                   
REMARK 500    GLN H  19       40.02   -106.73                                   
REMARK 500    LYS H  20     -138.28   -179.64                                   
REMARK 500    LYS H  21      -96.73     -1.04                                   
REMARK 500    LYS H  24       48.06    178.61                                   
REMARK 500    ARG H  26      -89.25    -52.78                                   
REMARK 500    ARG H  27       19.44    -65.09                                   
REMARK 500    THR H  29      101.36    -51.21                                   
REMARK 500    SER H 120       25.02    -66.45                                   
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: PLANAR GROUPS                                              
REMARK 500                                                                      
REMARK 500 PLANAR GROUPS IN THE FOLLOWING RESIDUES HAVE A TOTAL                 
REMARK 500 RMS DISTANCE OF ALL ATOMS FROM THE BEST-FIT PLANE                    
REMARK 500 BY MORE THAN AN EXPECTED VALUE OF 6*RMSD, WITH AN                    
REMARK 500 RMSD 0.02 ANGSTROMS, OR AT LEAST ONE ATOM HAS                        
REMARK 500 AN RMSD GREATER THAN THIS VALUE                                      
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        RMS     TYPE                                    
REMARK 500     DG I  -6         0.06    SIDE_CHAIN                              
REMARK 500     DA J -73         0.06    SIDE_CHAIN                              
REMARK 500     DT J -12         0.07    SIDE_CHAIN                              
REMARK 500     DG J  -6         0.07    SIDE_CHAIN                              
REMARK 500     DG J  -3         0.05    SIDE_CHAIN                              
REMARK 500     DA J   4         0.06    SIDE_CHAIN                              
REMARK 500     DC J   6         0.08    SIDE_CHAIN                              
REMARK 500     DG J  62         0.06    SIDE_CHAIN                              
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 525                                                                      
REMARK 525 SOLVENT                                                              
REMARK 525                                                                      
REMARK 525 THE SOLVENT MOLECULES HAVE CHAIN IDENTIFIERS THAT                    
REMARK 525 INDICATE THE POLYMER CHAIN WITH WHICH THEY ARE MOST                  
REMARK 525 CLOSELY ASSOCIATED. THE REMARK LISTS ALL THE SOLVENT                 
REMARK 525 MOLECULES WHICH ARE MORE THAN 5A AWAY FROM THE                       
REMARK 525 NEAREST POLYMER CHAIN (M = MODEL NUMBER;                             
REMARK 525 RES=RESIDUE NAME; C=CHAIN IDENTIFIER; SSEQ=SEQUENCE                  
REMARK 525 NUMBER; I=INSERTION CODE):                                           
REMARK 525                                                                      
REMARK 525  M RES CSSEQI                                                        
REMARK 525    HOH H3281        DISTANCE =  6.97 ANGSTROMS                       
REMARK 525    HOH D3299        DISTANCE =  6.02 ANGSTROMS                       
REMARK 525    HOH E3311        DISTANCE =  5.79 ANGSTROMS                       
REMARK 525    HOH C 294        DISTANCE =  8.69 ANGSTROMS                       
REMARK 525    HOH H3311        DISTANCE =  5.30 ANGSTROMS                       
REMARK 525    HOH G 300        DISTANCE =  8.00 ANGSTROMS                       
REMARK 525    HOH G 302        DISTANCE =  6.44 ANGSTROMS                       
REMARK 525    HOH H3319        DISTANCE =  6.69 ANGSTROMS                       
REMARK 525    HOH D3325        DISTANCE =  7.77 ANGSTROMS                       
REMARK 525    HOH G 307        DISTANCE =  9.30 ANGSTROMS                       
REMARK 525    HOH C 320        DISTANCE =  5.03 ANGSTROMS                       
REMARK 525    HOH A3357        DISTANCE =  8.41 ANGSTROMS                       
REMARK 525    HOH J3538        DISTANCE =  5.04 ANGSTROMS                       
REMARK 525    HOH J3599        DISTANCE =  6.09 ANGSTROMS                       
REMARK 525    HOH I3602        DISTANCE =  5.09 ANGSTROMS                       
REMARK 525    HOH I3632        DISTANCE =  5.20 ANGSTROMS                       
REMARK 525    HOH J3658        DISTANCE =  5.26 ANGSTROMS                       
REMARK 525    HOH J3687        DISTANCE =  6.40 ANGSTROMS                       
REMARK 525    HOH I3744        DISTANCE =  6.90 ANGSTROMS                       
REMARK 525    HOH J3772        DISTANCE =  6.40 ANGSTROMS                       
REMARK 525    HOH I3835        DISTANCE =  5.55 ANGSTROMS                       
REMARK 525    HOH J3839        DISTANCE =  6.52 ANGSTROMS                       
REMARK 525    HOH J3852        DISTANCE =  5.08 ANGSTROMS                       
REMARK 525    HOH J3854        DISTANCE =  5.97 ANGSTROMS                       
REMARK 525    HOH I3855        DISTANCE =  6.14 ANGSTROMS                       
REMARK 525    HOH I3857        DISTANCE =  5.82 ANGSTROMS                       
REMARK 525    HOH I3863        DISTANCE =  6.33 ANGSTROMS                       
REMARK 525    HOH I3874        DISTANCE =  7.19 ANGSTROMS                       
REMARK 525    HOH J3904        DISTANCE =  7.88 ANGSTROMS                       
REMARK 525    HOH J3932        DISTANCE =  6.24 ANGSTROMS                       
REMARK 525    HOH J3934        DISTANCE =  5.07 ANGSTROMS                       
REMARK 525    HOH J3943        DISTANCE =  8.97 ANGSTROMS                       
REMARK 620                                                                      
REMARK 620 METAL COORDINATION                                                   
REMARK 620  (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;              
REMARK 620  SSEQ=SEQUENCE NUMBER; I=INSERTION CODE):                            
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN E3132  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH E3214   O                                                      
REMARK 620 2 HOH F 154   O    91.2                                              
REMARK 620 3 HOH E3225   O   176.1  87.4                                        
REMARK 620 4 HOH E3195   O    91.7  88.7  91.9                                  
REMARK 620 5 ASP E  77   OD1  90.4 176.1  91.2  87.7                            
REMARK 620 6 VAL D  45   O    88.3  89.8  88.1 178.5  93.8                      
REMARK 620 N                    1     2     3     4     5                       
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I3136  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I3244   O                                                      
REMARK 620 2 HOH I3261   O    85.6                                              
REMARK 620 3 HOH J3212   O    86.9  77.0                                        
REMARK 620 4 HOH J3175   O   173.3 101.1  94.9                                  
REMARK 620 5 HOH I3771   O    92.5 165.1  88.1  81.1                            
REMARK 620 6 HOH I3212   O    93.9  95.3 172.2  85.2  99.7                      
REMARK 620 N                    1     2     3     4     5                       
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I3137  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I3251   O                                                      
REMARK 620 2 HOH I3193   O    83.7                                              
REMARK 620 3 HOH I3209   O    90.2 164.6                                        
REMARK 620 4  DG I  48   N7   86.2  86.8  78.7                                  
REMARK 620 5 HOH I3306   O   174.9  92.7  92.4  90.0                            
REMARK 620 N                    1     2     3     4                             
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I3138  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I3911   O                                                      
REMARK 620 2  DG I  61   N7   81.1                                              
REMARK 620 3 HOH I3201   O   159.4  98.8                                        
REMARK 620 4 HOH I3152   O    66.8  80.6  92.8                                  
REMARK 620 5 HOH I3181   O   111.4 101.4  88.9 177.2                            
REMARK 620 N                    1     2     3     4                             
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I3140  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I3243   O                                                      
REMARK 620 2  DG I  27   N7   93.1                                              
REMARK 620 3 HOH I3259   O    94.3  87.1                                        
REMARK 620 N                    1     2                                         
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I3141  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I3204   O                                                      
REMARK 620 2 HOH J3152   O   172.4                                              
REMARK 620 3 HOH J3240   O    85.9  91.9                                        
REMARK 620 4  DG I   5   O6   79.7  93.3  93.1                                  
REMARK 620 N                    1     2     3                                   
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I3142  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I3194   O                                                      
REMARK 620 2 HOH I3333   O    97.5                                              
REMARK 620 3  DG I  -3   N7   92.6 169.9                                        
REMARK 620 N                    1     2                                         
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN I3143  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH I3319   O                                                      
REMARK 620 2 HOH J3933   O    95.9                                              
REMARK 620 3  DG I -35   N7   93.4 168.2                                        
REMARK 620 4 HOH I3232   O    72.0  97.4  92.4                                  
REMARK 620 5 HOH I3217   O   153.1  76.5  98.2  83.3                            
REMARK 620 6  DG I -34   O6  113.7  84.1  85.6 174.0  91.5                      
REMARK 620 N                    1     2     3     4     5                       
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J3131  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J3656   O                                                      
REMARK 620 2 HOH J3694   O    98.3                                              
REMARK 620 3 HOH J3430   O    73.5 167.7                                        
REMARK 620 4 HOH J3274   O    80.2  88.1  81.5                                  
REMARK 620 5 HOH J3221   O    96.4  90.7  99.2 176.2                            
REMARK 620 6  DG J  61   N7  165.7  88.8  97.3  87.7  95.9                      
REMARK 620 N                    1     2     3     4     5                       
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J3133  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J3262   O                                                      
REMARK 620 2 HOH J3208   O    83.7                                              
REMARK 620 3  DG J  27   N7   93.0  94.0                                        
REMARK 620 4 HOH J3209   O   166.3 108.6  80.5                                  
REMARK 620 5 HOH I3221   O    98.4 175.9  82.4  69.0                            
REMARK 620 6 HOH I3158   O    91.3  95.4 170.0  93.3  88.1                      
REMARK 620 N                    1     2     3     4     5                       
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J3134  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J3917   O                                                      
REMARK 620 2 HOH J3169   O    73.7                                              
REMARK 620 3 HOH J3307   O    88.9 162.1                                        
REMARK 620 4 HOH J3226   O   171.7  98.5  98.6                                  
REMARK 620 5 HOH J3195   O   104.4  77.1 104.2  70.5                            
REMARK 620 6  DG J  -3   N7   86.6  91.3  91.6  96.6 160.7                      
REMARK 620 N                    1     2     3     4     5                       
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J3135  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J3316   O                                                      
REMARK 620 2 HOH J3317   O    94.8                                              
REMARK 620 3 HOH J3211   O    76.3 170.4                                        
REMARK 620 4 HOH J3201   O    87.6  90.2  92.9                                  
REMARK 620 5  DG J  48   N7  174.6  80.7 108.3  89.4                            
REMARK 620 N                    1     2     3     4                             
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J3139  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J3238   O                                                      
REMARK 620 2 HOH J3331   O    96.7                                              
REMARK 620 3  DG J -35   N7   94.8  74.8                                        
REMARK 620 4 HOH J3215   O    88.7 171.9  98.8                                  
REMARK 620 5  DG J -34   O6  169.9  90.9  80.7  83.1                            
REMARK 620 N                    1     2     3     4                             
REMARK 620                                                                      
REMARK 620 COORDINATION ANGLES FOR:  M RES CSSEQI METAL                         
REMARK 620                              MN J3144  MN                            
REMARK 620 N RES CSSEQI ATOM                                                    
REMARK 620 1 HOH J3672   O                                                      
REMARK 620 2 HOH I3923   O    63.9                                              
REMARK 620 3 HOH I3396   O   130.0  66.3                                        
REMARK 620 4  DG J   5   O6   94.4  79.6  80.8                                  
REMARK 620 5 HOH J3230   O   114.3 153.5 111.9  74.1                            
REMARK 620 N                    1     2     3     4                             
REMARK 800                                                                      
REMARK 800 SITE                                                                 
REMARK 800 SITE_IDENTIFIER: AC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 3131                 
REMARK 800 SITE_IDENTIFIER: AC2                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN E 3132                 
REMARK 800 SITE_IDENTIFIER: AC3                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 3133                 
REMARK 800 SITE_IDENTIFIER: AC4                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 3134                 
REMARK 800 SITE_IDENTIFIER: AC5                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 3135                 
REMARK 800 SITE_IDENTIFIER: AC6                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 3136                 
REMARK 800 SITE_IDENTIFIER: AC7                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 3137                 
REMARK 800 SITE_IDENTIFIER: AC8                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 3138                 
REMARK 800 SITE_IDENTIFIER: AC9                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 3139                 
REMARK 800 SITE_IDENTIFIER: BC1                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 3140                 
REMARK 800 SITE_IDENTIFIER: BC2                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 3141                 
REMARK 800 SITE_IDENTIFIER: BC3                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 3142                 
REMARK 800 SITE_IDENTIFIER: BC4                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN I 3143                 
REMARK 800 SITE_IDENTIFIER: BC5                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE MN J 3144                 
REMARK 800 SITE_IDENTIFIER: BC6                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL H 3145                 
REMARK 800 SITE_IDENTIFIER: BC7                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL D 3146                 
REMARK 800 SITE_IDENTIFIER: BC8                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL A 3147                 
REMARK 800 SITE_IDENTIFIER: BC9                                                 
REMARK 800 EVIDENCE_CODE: SOFTWARE                                              
REMARK 800 SITE_DESCRIPTION: BINDING SITE FOR RESIDUE CL E 3148                 
REMARK 900                                                                      
REMARK 900 RELATED ENTRIES                                                      
REMARK 900 RELATED ID: 1AOI   RELATED DB: PDB                                   
REMARK 900 NCP146 AT 2.8 A                                                      
REMARK 900 RELATED ID: 1KX3   RELATED DB: PDB                                   
REMARK 900 NCP146 AT 2.0 A                                                      
REMARK 900 RELATED ID: 1KX4   RELATED DB: PDB                                   
REMARK 900 NCP146B AT 2.6 A                                                     
DBREF  1KX5 A    1   135  UNP    P16105   H32_BOVIN        1    135             
DBREF  1KX5 E    1   135  UNP    P16105   H32_BOVIN        1    135             
DBREF  1KX5 B    1   102  UNP    P02304   H4_HUMANX        1    102             
DBREF  1KX5 F    1   102  UNP    P02304   H4_HUMANX        1    102             
DBREF  1KX5 C    1   128  UNP    P06897   H2A1_XENLA       1    129             
DBREF  1KX5 G    1   128  UNP    P06897   H2A1_XENLA       1    129             
DBREF  1KX5 D   -2   122  UNP    P02281   H2B1_XENLA       1    125             
DBREF  1KX5 H   -2   122  UNP    P02281   H2B1_XENLA       1    125             
DBREF  1KX5 I  -73    73  PDB    1KX5     1KX5           -73     73             
DBREF  1KX5 J  -73    73  PDB    1KX5     1KX5           -73     73             
SEQADV 1KX5 ALA A  102  UNP  P16105    GLY   102 CONFLICT                       
SEQADV 1KX5 ALA E  102  UNP  P16105    GLY   102 CONFLICT                       
SEQADV 1KX5 ARG C   99  UNP  P06897    GLY    99 VARIANT                        
SEQADV 1KX5 SER C  123  UNP  P06897    ALA   123 CONFLICT                       
SEQADV 1KX5     C       UNP  P06897    ALA   126 DELETION                       
SEQADV 1KX5 ARG G   99  UNP  P06897    GLY    99 VARIANT                        
SEQADV 1KX5 SER G  123  UNP  P06897    ALA   123 CONFLICT                       
SEQADV 1KX5     G       UNP  P06897    ALA   126 DELETION                       
SEQADV 1KX5 THR D   29  UNP  P02281    SER    32 VARIANT                        
SEQADV 1KX5 THR H   29  UNP  P02281    SER    32 VARIANT                        
SEQRES   1 I  147   DA  DT  DC  DA  DA  DT  DA  DT  DC  DC  DA  DC  DC          
SEQRES   2 I  147   DT  DG  DC  DA  DG  DA  DT  DA  DC  DT  DA  DC  DC          
SEQRES   3 I  147   DA  DA  DA  DA  DG  DT  DG  DT  DA  DT  DT  DT  DG          
SEQRES   4 I  147   DG  DA  DA  DA  DC  DT  DG  DC  DT  DC  DC  DA  DT          
SEQRES   5 I  147   DC  DA  DA  DA  DA  DG  DG  DC  DA  DT  DG  DT  DT          
SEQRES   6 I  147   DC  DA  DG  DC  DT  DG  DG  DA  DA  DT  DC  DC  DA          
SEQRES   7 I  147   DG  DC  DT  DG  DA  DA  DC  DA  DT  DG  DC  DC  DT          
SEQRES   8 I  147   DT  DT  DT  DG  DA  DT  DG  DG  DA  DG  DC  DA  DG          
SEQRES   9 I  147   DT  DT  DT  DC  DC  DA  DA  DA  DT  DA  DC  DA  DC          
SEQRES  10 I  147   DT  DT  DT  DT  DG  DG  DT  DA  DG  DT  DA  DT  DC          
SEQRES  11 I  147   DT  DG  DC  DA  DG  DG  DT  DG  DG  DA  DT  DA  DT          
SEQRES  12 I  147   DT  DG  DA  DT                                              
SEQRES   1 J  147   DA  DT  DC  DA  DA  DT  DA  DT  DC  DC  DA  DC  DC          
SEQRES   2 J  147   DT  DG  DC  DA  DG  DA  DT  DA  DC  DT  DA  DC  DC          
SEQRES   3 J  147   DA  DA  DA  DA  DG  DT  DG  DT  DA  DT  DT  DT  DG          
SEQRES   4 J  147   DG  DA  DA  DA  DC  DT  DG  DC  DT  DC  DC  DA  DT          
SEQRES   5 J  147   DC  DA  DA  DA  DA  DG  DG  DC  DA  DT  DG  DT  DT          
SEQRES   6 J  147   DC  DA  DG  DC  DT  DG  DG  DA  DT  DT  DC  DC  DA          
SEQRES   7 J  147   DG  DC  DT  DG  DA  DA  DC  DA  DT  DG  DC  DC  DT          
SEQRES   8 J  147   DT  DT  DT  DG  DA  DT  DG  DG  DA  DG  DC  DA  DG          
SEQRES   9 J  147   DT  DT  DT  DC  DC  DA  DA  DA  DT  DA  DC  DA  DC          
SEQRES  10 J  147   DT  DT  DT  DT  DG  DG  DT  DA  DG  DT  DA  DT  DC          
SEQRES  11 J  147   DT  DG  DC  DA  DG  DG  DT  DG  DG  DA  DT  DA  DT          
SEQRES  12 J  147   DT  DG  DA  DT                                              
SEQRES   1 A  135  ALA ARG THR LYS GLN THR ALA ARG LYS SER THR GLY GLY          
SEQRES   2 A  135  LYS ALA PRO ARG LYS GLN LEU ALA THR LYS ALA ALA ARG          
SEQRES   3 A  135  LYS SER ALA PRO ALA THR GLY GLY VAL LYS LYS PRO HIS          
SEQRES   4 A  135  ARG TYR ARG PRO GLY THR VAL ALA LEU ARG GLU ILE ARG          
SEQRES   5 A  135  ARG TYR GLN LYS SER THR GLU LEU LEU ILE ARG LYS LEU          
SEQRES   6 A  135  PRO PHE GLN ARG LEU VAL ARG GLU ILE ALA GLN ASP PHE          
SEQRES   7 A  135  LYS THR ASP LEU ARG PHE GLN SER SER ALA VAL MET ALA          
SEQRES   8 A  135  LEU GLN GLU ALA SER GLU ALA TYR LEU VAL ALA LEU PHE          
SEQRES   9 A  135  GLU ASP THR ASN LEU CYS ALA ILE HIS ALA LYS ARG VAL          
SEQRES  10 A  135  THR ILE MET PRO LYS ASP ILE GLN LEU ALA ARG ARG ILE          
SEQRES  11 A  135  ARG GLY GLU ARG ALA                                          
SEQRES   1 B  102  SER GLY ARG GLY LYS GLY GLY LYS GLY LEU GLY LYS GLY          
SEQRES   2 B  102  GLY ALA LYS ARG HIS ARG LYS VAL LEU ARG ASP ASN ILE          
SEQRES   3 B  102  GLN GLY ILE THR LYS PRO ALA ILE ARG ARG LEU ALA ARG          
SEQRES   4 B  102  ARG GLY GLY VAL LYS ARG ILE SER GLY LEU ILE TYR GLU          
SEQRES   5 B  102  GLU THR ARG GLY VAL LEU LYS VAL PHE LEU GLU ASN VAL          
SEQRES   6 B  102  ILE ARG ASP ALA VAL THR TYR THR GLU HIS ALA LYS ARG          
SEQRES   7 B  102  LYS THR VAL THR ALA MET ASP VAL VAL TYR ALA LEU LYS          
SEQRES   8 B  102  ARG GLN GLY ARG THR LEU TYR GLY PHE GLY GLY                  
SEQRES   1 C  128  SER GLY ARG GLY LYS GLN GLY GLY LYS THR ARG ALA LYS          
SEQRES   2 C  128  ALA LYS THR ARG SER SER ARG ALA GLY LEU GLN PHE PRO          
SEQRES   3 C  128  VAL GLY ARG VAL HIS ARG LEU LEU ARG LYS GLY ASN TYR          
SEQRES   4 C  128  ALA GLU ARG VAL GLY ALA GLY ALA PRO VAL TYR LEU ALA          
SEQRES   5 C  128  ALA VAL LEU GLU TYR LEU THR ALA GLU ILE LEU GLU LEU          
SEQRES   6 C  128  ALA GLY ASN ALA ALA ARG ASP ASN LYS LYS THR ARG ILE          
SEQRES   7 C  128  ILE PRO ARG HIS LEU GLN LEU ALA VAL ARG ASN ASP GLU          
SEQRES   8 C  128  GLU LEU ASN LYS LEU LEU GLY ARG VAL THR ILE ALA GLN          
SEQRES   9 C  128  GLY GLY VAL LEU PRO ASN ILE GLN SER VAL LEU LEU PRO          
SEQRES  10 C  128  LYS LYS THR GLU SER SER LYS SER LYS SER LYS                  
SEQRES   1 D  125  PRO GLU PRO ALA LYS SER ALA PRO ALA PRO LYS LYS GLY          
SEQRES   2 D  125  SER LYS LYS ALA VAL THR LYS THR GLN LYS LYS ASP GLY          
SEQRES   3 D  125  LYS LYS ARG ARG LYS THR ARG LYS GLU SER TYR ALA ILE          
SEQRES   4 D  125  TYR VAL TYR LYS VAL LEU LYS GLN VAL HIS PRO ASP THR          
SEQRES   5 D  125  GLY ILE SER SER LYS ALA MET SER ILE MET ASN SER PHE          
SEQRES   6 D  125  VAL ASN ASP VAL PHE GLU ARG ILE ALA GLY GLU ALA SER          
SEQRES   7 D  125  ARG LEU ALA HIS TYR ASN LYS ARG SER THR ILE THR SER          
SEQRES   8 D  125  ARG GLU ILE GLN THR ALA VAL ARG LEU LEU LEU PRO GLY          
SEQRES   9 D  125  GLU LEU ALA LYS HIS ALA VAL SER GLU GLY THR LYS ALA          
SEQRES  10 D  125  VAL THR LYS TYR THR SER ALA LYS                              
SEQRES   1 E  135  ALA ARG THR LYS GLN THR ALA ARG LYS SER THR GLY GLY          
SEQRES   2 E  135  LYS ALA PRO ARG LYS GLN LEU ALA THR LYS ALA ALA ARG          
SEQRES   3 E  135  LYS SER ALA PRO ALA THR GLY GLY VAL LYS LYS PRO HIS          
SEQRES   4 E  135  ARG TYR ARG PRO GLY THR VAL ALA LEU ARG GLU ILE ARG          
SEQRES   5 E  135  ARG TYR GLN LYS SER THR GLU LEU LEU ILE ARG LYS LEU          
SEQRES   6 E  135  PRO PHE GLN ARG LEU VAL ARG GLU ILE ALA GLN ASP PHE          
SEQRES   7 E  135  LYS THR ASP LEU ARG PHE GLN SER SER ALA VAL MET ALA          
SEQRES   8 E  135  LEU GLN GLU ALA SER GLU ALA TYR LEU VAL ALA LEU PHE          
SEQRES   9 E  135  GLU ASP THR ASN LEU CYS ALA ILE HIS ALA LYS ARG VAL          
SEQRES  10 E  135  THR ILE MET PRO LYS ASP ILE GLN LEU ALA ARG ARG ILE          
SEQRES  11 E  135  ARG GLY GLU ARG ALA                                          
SEQRES   1 F  102  SER GLY ARG GLY LYS GLY GLY LYS GLY LEU GLY LYS GLY          
SEQRES   2 F  102  GLY ALA LYS ARG HIS ARG LYS VAL LEU ARG ASP ASN ILE          
SEQRES   3 F  102  GLN GLY ILE THR LYS PRO ALA ILE ARG ARG LEU ALA ARG          
SEQRES   4 F  102  ARG GLY GLY VAL LYS ARG ILE SER GLY LEU ILE TYR GLU          
SEQRES   5 F  102  GLU THR ARG GLY VAL LEU LYS VAL PHE LEU GLU ASN VAL          
SEQRES   6 F  102  ILE ARG ASP ALA VAL THR TYR THR GLU HIS ALA LYS ARG          
SEQRES   7 F  102  LYS THR VAL THR ALA MET ASP VAL VAL TYR ALA LEU LYS          
SEQRES   8 F  102  ARG GLN GLY ARG THR LEU TYR GLY PHE GLY GLY                  
SEQRES   1 G  128  SER GLY ARG GLY LYS GLN GLY GLY LYS THR ARG ALA LYS          
SEQRES   2 G  128  ALA LYS THR ARG SER SER ARG ALA GLY LEU GLN PHE PRO          
SEQRES   3 G  128  VAL GLY ARG VAL HIS ARG LEU LEU ARG LYS GLY ASN TYR          
SEQRES   4 G  128  ALA GLU ARG VAL GLY ALA GLY ALA PRO VAL TYR LEU ALA          
SEQRES   5 G  128  ALA VAL LEU GLU TYR LEU THR ALA GLU ILE LEU GLU LEU          
SEQRES   6 G  128  ALA GLY ASN ALA ALA ARG ASP ASN LYS LYS THR ARG ILE          
SEQRES   7 G  128  ILE PRO ARG HIS LEU GLN LEU ALA VAL ARG ASN ASP GLU          
SEQRES   8 G  128  GLU LEU ASN LYS LEU LEU GLY ARG VAL THR ILE ALA GLN          
SEQRES   9 G  128  GLY GLY VAL LEU PRO ASN ILE GLN SER VAL LEU LEU PRO          
SEQRES  10 G  128  LYS LYS THR GLU SER SER LYS SER LYS SER LYS                  
SEQRES   1 H  125  PRO GLU PRO ALA LYS SER ALA PRO ALA PRO LYS LYS GLY          
SEQRES   2 H  125  SER LYS LYS ALA VAL THR LYS THR GLN LYS LYS ASP GLY          
SEQRES   3 H  125  LYS LYS ARG ARG LYS THR ARG LYS GLU SER TYR ALA ILE          
SEQRES   4 H  125  TYR VAL TYR LYS VAL LEU LYS GLN VAL HIS PRO ASP THR          
SEQRES   5 H  125  GLY ILE SER SER LYS ALA MET SER ILE MET ASN SER PHE          
SEQRES   6 H  125  VAL ASN ASP VAL PHE GLU ARG ILE ALA GLY GLU ALA SER          
SEQRES   7 H  125  ARG LEU ALA HIS TYR ASN LYS ARG SER THR ILE THR SER          
SEQRES   8 H  125  ARG GLU ILE GLN THR ALA VAL ARG LEU LEU LEU PRO GLY          
SEQRES   9 H  125  GLU LEU ALA LYS HIS ALA VAL SER GLU GLY THR LYS ALA          
SEQRES  10 H  125  VAL THR LYS TYR THR SER ALA LYS                              
HET     MN  J3131       1                                                       
HET     MN  E3132       1                                                       
HET     MN  J3133       1                                                       
HET     MN  J3134       1                                                       
HET     MN  J3135       1                                                       
HET     MN  I3136       1                                                       
HET     MN  I3137       1                                                       
HET     MN  I3138       1                                                       
HET     MN  J3139       1                                                       
HET     MN  I3140       1                                                       
HET     MN  I3141       1                                                       
HET     MN  I3142       1                                                       
HET     MN  I3143       1                                                       
HET     MN  J3144       1                                                       
HET     CL  H3145       1                                                       
HET     CL  D3146       1                                                       
HET     CL  A3147       1                                                       
HET     CL  E3148       1                                                       
HETNAM      MN MANGANESE (II) ION                                               
HETNAM      CL CHLORIDE ION                                                     
FORMUL  11   MN    14(MN 2+)                                                    
FORMUL  25   CL    4(CL 1-)                                                     
FORMUL  29  HOH   *3130(H2 O)                                                   
HELIX    1   1 LYS H   21  GLY H   23  1                                   3
HELIX    2   2 ALA H   35  VAL H   45  1                                  11
HELIX    3   3 SER H   53  TYR H   80  1                                  28
HELIX    4   4 SER H   88  LEU H   98  1                                  11
HELIX    5   5 GLY H  101  THR H  119  1                                  19
LINK        MN    MN E3132                 O   HOH E3214     1555   1555  2.15  
LINK        MN    MN E3132                 O   HOH F 154     1555   1555  2.28  
LINK        MN    MN E3132                 O   HOH E3225     1555   1555  2.23  
LINK        MN    MN E3132                 O   HOH E3195     1555   1555  2.34  
LINK        MN    MN E3132                 OD1 ASP E  77     1555   1555  2.24  
LINK        MN    MN I3136                 O   HOH I3244     1555   1555  2.36  
LINK        MN    MN I3136                 O   HOH I3261     1555   1555  2.48  
LINK        MN    MN I3136                 O   HOH J3212     1555   1555  2.15  
LINK        MN    MN I3136                 O   HOH J3175     1555   1555  2.41  
LINK        MN    MN I3136                 O   HOH I3771     1555   1555  2.30  
LINK        MN    MN I3136                 O   HOH I3212     1555   1555  2.18  
LINK        MN    MN I3137                 O   HOH I3251     1555   1555  2.34  
LINK        MN    MN I3137                 O   HOH I3193     1555   1555  2.69  
LINK        MN    MN I3137                 O   HOH I3209     1555   1555  2.60  
LINK        MN    MN I3137                 N7   DG I  48     1555   1555  2.52  
LINK        MN    MN I3137                 O   HOH I3306     1555   1555  2.27  
LINK        MN    MN I3138                 O   HOH I3911     1555   1555  2.52  
LINK        MN    MN I3138                 N7   DG I  61     1555   1555  2.54  
LINK        MN    MN I3138                 O   HOH I3201     1555   1555  2.65  
LINK        MN    MN I3138                 O   HOH I3152     1555   1555  2.40  
LINK        MN    MN I3138                 O   HOH I3181     1555   1555  2.47  
LINK        MN    MN I3140                 O   HOH I3243     1555   1555  2.57  
LINK        MN    MN I3140                 N7   DG I  27     1555   1555  2.45  
LINK        MN    MN I3140                 O   HOH I3259     1555   1555  2.43  
LINK        MN    MN I3141                 O   HOH I3204     1555   1555  2.49  
LINK        MN    MN I3141                 O   HOH J3152     1555   1555  2.26  
LINK        MN    MN I3141                 O   HOH J3240     1555   1555  2.17  
LINK        MN    MN I3141                 O6   DG I   5     1555   1555  2.54  
LINK        MN    MN I3142                 O   HOH I3194     1555   1555  2.57  
LINK        MN    MN I3142                 O   HOH I3333     1555   1555  2.42  
LINK        MN    MN I3142                 N7   DG I  -3     1555   1555  2.49  
LINK        MN    MN I3143                 O   HOH I3319     1555   1555  2.46  
LINK        MN    MN I3143                 O   HOH J3933     1555   1555  2.73  
LINK        MN    MN I3143                 N7   DG I -35     1555   1555  2.39  
LINK        MN    MN I3143                 O   HOH I3232     1555   1555  2.25  
LINK        MN    MN I3143                 O   HOH I3217     1555   1555  2.52  
LINK        MN    MN I3143                 O6   DG I -34     1555   1555  2.55  
LINK        MN    MN J3131                 O   HOH J3656     1555   1555  2.46  
LINK        MN    MN J3131                 O   HOH J3694     1555   1555  2.50  
LINK        MN    MN J3131                 O   HOH J3430     1555   1555  2.42  
LINK        MN    MN J3131                 O   HOH J3274     1555   1555  2.47  
LINK        MN    MN J3131                 O   HOH J3221     1555   1555  2.55  
LINK        MN    MN J3131                 N7   DG J  61     1555   1555  2.61  
LINK        MN    MN J3133                 O   HOH J3262     1555   1555  2.28  
LINK        MN    MN J3133                 O   HOH J3208     1555   1555  2.20  
LINK        MN    MN J3133                 N7   DG J  27     1555   1555  2.40  
LINK        MN    MN J3133                 O   HOH J3209     1555   1555  2.38  
LINK        MN    MN J3133                 O   HOH I3221     1555   1555  2.16  
LINK        MN    MN J3133                 O   HOH I3158     1555   1555  2.54  
LINK        MN    MN J3134                 O   HOH J3917     1555   1555  2.50  
LINK        MN    MN J3134                 O   HOH J3169     1555   1555  2.54  
LINK        MN    MN J3134                 O   HOH J3307     1555   1555  2.31  
LINK        MN    MN J3134                 O   HOH J3226     1555   1555  2.32  
LINK        MN    MN J3134                 O   HOH J3195     1555   1555  2.53  
LINK        MN    MN J3134                 N7   DG J  -3     1555   1555  2.38  
LINK        MN    MN J3135                 O   HOH J3316     1555   1555  2.59  
LINK        MN    MN J3135                 O   HOH J3317     1555   1555  2.22  
LINK        MN    MN J3135                 O   HOH J3211     1555   1555  2.34  
LINK        MN    MN J3135                 O   HOH J3201     1555   1555  2.46  
LINK        MN    MN J3135                 N7   DG J  48     1555   1555  2.43  
LINK        MN    MN J3139                 O   HOH J3238     1555   1555  2.34  
LINK        MN    MN J3139                 O   HOH J3331     1555   1555  2.56  
LINK        MN    MN J3139                 N7   DG J -35     1555   1555  2.60  
LINK        MN    MN J3139                 O   HOH J3215     1555   1555  2.60  
LINK        MN    MN J3139                 O6   DG J -34     1555   1555  2.43  
LINK        MN    MN J3144                 O   HOH J3672     1555   1555  2.43  
LINK        MN    MN J3144                 O   HOH I3923     1555   1555  2.38  
LINK        MN    MN J3144                 O   HOH I3396     1555   1555  2.45  
LINK        MN    MN J3144                 O6   DG J   5     1555   1555  2.43  
LINK        MN    MN J3144                 O   HOH J3230     1555   1555  2.62  
LINK        MN    MN E3132                 O   VAL D  45     1555   2564  2.25  
CISPEP   1 ALA D    4    PRO D    5          0         0.54                     
CISPEP   2 ALA D    6    PRO D    7          0        -0.17                     
SITE     1 AC1  6  DG J  61  HOH J3221  HOH J3274  HOH J3430                    
SITE     2 AC1  6 HOH J3656  HOH J3694                                          
SITE     1 AC2  6 VAL D  45  ASP E  77  HOH E3195  HOH E3214                    
SITE     2 AC2  6 HOH E3225  HOH F 154                                          
SITE     1 AC3  6 HOH I3158  HOH I3221   DG J  27  HOH J3208                    
SITE     2 AC3  6 HOH J3209  HOH J3262                                          
SITE     1 AC4  6  DG J  -3  HOH J3169  HOH J3195  HOH J3226                    
SITE     2 AC4  6 HOH J3307  HOH J3917                                          
SITE     1 AC5  5  DG J  48  HOH J3201  HOH J3211  HOH J3316                    
SITE     2 AC5  5 HOH J3317                                                     
SITE     1 AC6  6 HOH I3212  HOH I3244  HOH I3261  HOH I3771                    
SITE     2 AC6  6 HOH J3175  HOH J3212                                          
SITE     1 AC7  5  DG I  48  HOH I3193  HOH I3209  HOH I3251                    
SITE     2 AC7  5 HOH I3306                                                     
SITE     1 AC8  5  DG I  61  HOH I3152  HOH I3181  HOH I3201                    
SITE     2 AC8  5 HOH I3911                                                     
SITE     1 AC9  5  DG J -34   DG J -35  HOH J3215  HOH J3238                    
SITE     2 AC9  5 HOH J3331                                                     
SITE     1 BC1  4  DG I  27  HOH I3243  HOH I3259  HOH J3931                    
SITE     1 BC2  4  DG I   5  HOH I3204  HOH J3152  HOH J3240                    
SITE     1 BC3  4  DG I  -3   DG I  -2  HOH I3194  HOH I3333                    
SITE     1 BC4  6  DG I -35   DG I -34  HOH I3217  HOH I3232                    
SITE     2 BC4  6 HOH I3319  HOH J3933                                          
SITE     1 BC5  5 HOH I3396  HOH I3923   DG J   5  HOH J3230                    
SITE     2 BC5  5 HOH J3672                                                     
SITE     1 BC6  5 GLY G  44  GLY G  46  ALA G  47  THR H  87                    
SITE     2 BC6  5 SER H  88                                                     
SITE     1 BC7  5 GLY C  44  GLY C  46  ALA C  47  THR D  87                    
SITE     2 BC7  5 SER D  88                                                     
SITE     1 BC8  2 PRO A 121  LYS A 122                                          
SITE     1 BC9  2 PRO E 121  LYS E 122                                          
CRYST1  105.950  181.170  109.490  90.00  90.00  90.00 P 21 21 21    8          
ORIGX1      1.000000  0.000000  0.000000        0.00000                         
ORIGX2      0.000000  1.000000  0.000000        0.00000                         
ORIGX3      0.000000  0.000000  1.000000        0.00000                         
SCALE1      0.009438  0.000000  0.000000        0.00000                         
SCALE2      0.000000  0.005520  0.000000        0.00000                         
SCALE3      0.000000  0.000000  0.009133        0.00000                         
ATOM      1  N   ALA H   1     101.259  42.382  28.522  0.00 92.52           N
ATOM      2  CA  ALA H   1     101.384  41.308  27.496  0.00 92.52           C
ATOM      3  C   ALA H   1     100.905  41.803  26.136  0.00 92.52           C
ATOM      4  O   ALA H   1     100.718  41.015  25.209  0.00 92.52           O
ATOM      5  CB  ALA H   1     100.576  40.088  27.922  0.00 92.52           C
ATOM      6  N   LYS H   2     100.710  43.113  26.023  0.00 92.52           N
ATOM      7  CA  LYS H   2     100.254  43.716  24.777  0.00 92.53           C
ATOM      8  C   LYS H   2     101.393  44.440  24.069  0.00 92.53           C
ATOM      9  O   LYS H   2     102.383  44.821  24.695  0.00 92.53           O
ATOM     10  CB  LYS H   2      99.114  44.699  25.053  0.00 92.52           C
ATOM     11  CG  LYS H   2      97.886  44.066  25.688  0.00 92.52           C
ATOM     12  CD  LYS H   2      96.795  45.097  25.926  0.00 92.51           C
ATOM     13  CE  LYS H   2      95.562  44.464  26.548  0.00 92.51           C
ATOM     14  NZ  LYS H   2      95.865  43.830  27.861  0.00 92.51           N
ATOM     15  N   SER H   3     101.246  44.627  22.762  0.00 92.54           N
ATOM     16  CA  SER H   3     102.259  45.306  21.964  0.00 92.56           C
ATOM     17  C   SER H   3     101.693  46.582  21.351  0.00 92.57           C
ATOM     18  O   SER H   3     102.209  47.084  20.352  0.00 92.57           O
ATOM     19  CB  SER H   3     102.764  44.381  20.854  0.00 92.55           C
ATOM     20  OG  SER H   3     101.707  43.992  19.994  0.00 92.55           O
ATOM     21  N   ALA H   4     100.630  47.100  21.958  0.00 92.58           N
ATOM     22  CA  ALA H   4      99.984  48.318  21.481  0.00 92.60           C
ATOM     23  C   ALA H   4      99.555  48.177  20.023  0.00 92.61           C
ATOM     24  O   ALA H   4     100.109  48.828  19.137  0.00 92.61           O
ATOM     25  CB  ALA H   4     100.928  49.505  21.638  0.00 92.59           C
ATOM     26  N   PRO H   5      98.558  47.317  19.757  0.00 92.63           N
ATOM     27  CA  PRO H   5      98.049  47.087  18.401  0.00 92.64           C
ATOM     28  C   PRO H   5      97.659  48.380  17.689  0.00 92.66           C
ATOM     29  O   PRO H   5      97.613  48.434  16.460  0.00 92.66           O
ATOM     30  CB  PRO H   5      96.851  46.174  18.638  0.00 92.64           C
ATOM     31  CG  PRO H   5      97.280  45.378  19.828  0.00 92.63           C
ATOM     32  CD  PRO H   5      97.870  46.443  20.724  0.00 92.63           C
ATOM     33  N   ALA H   6      97.379  49.419  18.470  0.00 92.69           N
ATOM     34  CA  ALA H   6      96.993  50.712  17.918  0.00 92.72           C
ATOM     35  C   ALA H   6      97.606  51.851  18.728  0.00 92.74           C
ATOM     36  O   ALA H   6      97.638  51.804  19.958  0.00 92.74           O
ATOM     37  CB  ALA H   6      95.475  50.839  17.904  0.00 92.71           C
ATOM     38  N   PRO H   7      98.103  52.893  18.042  0.00 92.76           N
ATOM     39  CA  PRO H   7      98.718  54.049  18.700  0.00 92.79           C
ATOM     40  C   PRO H   7      97.704  54.903  19.457  0.00 92.81           C
ATOM     41  O   PRO H   7      96.546  54.514  19.614  0.00 92.82           O
ATOM     42  CB  PRO H   7      99.355  54.801  17.537  0.00 92.78           C
ATOM     43  CG  PRO H   7      98.396  54.535  16.421  0.00 92.77           C
ATOM     44  CD  PRO H   7      98.125  53.055  16.577  0.00 92.77           C
ATOM     45  N   LYS H   8      98.147  56.066  19.924  0.00 92.85           N
ATOM     46  CA  LYS H   8      97.280  56.974  20.664  0.00 92.88           C
ATOM     47  C   LYS H   8      97.080  58.284  19.909  0.00 92.91           C
ATOM     48  O   LYS H   8      97.583  59.331  20.318  0.00 92.92           O
ATOM     49  CB  LYS H   8      97.874  57.261  22.046  0.00 92.88           C
ATOM     50  CG  LYS H   8      98.023  56.030  22.925  0.00 92.88           C
ATOM     51  CD  LYS H   8      98.607  56.389  24.282  0.00 92.87           C
ATOM     52  CE  LYS H   8      98.739  55.162  25.169  0.00 92.87           C
ATOM     53  NZ  LYS H   8      97.422  54.513  25.417  0.00 92.87           N
ATOM     54  N   LYS H   9      96.344  58.218  18.805  0.00 92.95           N
ATOM     55  CA  LYS H   9      96.073  59.397  17.991  0.00 92.99           C
ATOM     56  C   LYS H   9      94.572  59.581  17.799  0.00 93.02           C
ATOM     57  O   LYS H   9      94.135  60.305  16.903  0.00 93.02           O
ATOM     58  CB  LYS H   9      96.756  59.266  16.627  0.00 92.99           C
ATOM     59  CG  LYS H   9      98.268  59.112  16.701  0.00 92.99           C
ATOM     60  CD  LYS H   9      98.902  59.025  15.317  0.00 92.99           C
ATOM     61  CE  LYS H   9      98.815  60.346  14.560  0.00 92.99           C
ATOM     62  NZ  LYS H   9      97.417  60.749  14.242  0.00 92.99           N
ATOM     63  N   GLY H  10      93.789  58.922  18.646  0.00 93.06           N
ATOM     64  CA  GLY H  10      92.345  59.024  18.554  0.00 93.10           C
ATOM     65  C   GLY H  10      91.641  57.922  19.320  0.00 93.13           C
ATOM     66  O   GLY H  10      91.689  57.880  20.549  0.00 93.13           O
ATOM     67  N   SER H  11      90.984  57.025  18.591  0.00 93.16           N
ATOM     68  CA  SER H  11      90.266  55.915  19.206  0.00 93.20           C
ATOM     69  C   SER H  11      90.637  54.593  18.544  0.00 93.22           C
ATOM     70  O   SER H  11      91.065  54.564  17.390  0.00 93.23           O
ATOM     71  CB  SER H  11      88.756  56.139  19.097  0.00 93.20           C
ATOM     72  OG  SER H  11      88.350  56.232  17.743  0.00 93.20           O
ATOM     73  N   LYS H  12      90.471  53.501  19.283  0.00 93.25           N
ATOM     74  CA  LYS H  12      90.787  52.172  18.772  0.00 93.28           C
ATOM     75  C   LYS H  12      89.556  51.502  18.172  0.00 93.29           C
ATOM     76  O   LYS H  12      88.460  52.063  18.192  0.00 93.29           O
ATOM     77  CB  LYS H  12      91.357  51.302  19.896  0.00 93.29           C
ATOM     78  CG  LYS H  12      90.478  51.229  21.133  0.00 93.30           C
ATOM     79  CD  LYS H  12      91.123  50.384  22.219  0.00 93.31           C
ATOM     80  CE  LYS H  12      90.285  50.381  23.487  0.00 93.32           C
ATOM     81  NZ  LYS H  12      90.129  51.752  24.049  0.00 93.32           N
ATOM     82  N   LYS H  13      89.745  50.300  17.637  0.00 93.30           N
ATOM     83  CA  LYS H  13      88.654  49.550  17.026  0.00 93.32           C
ATOM     84  C   LYS H  13      87.875  48.753  18.065  0.00 93.32           C
ATOM     85  O   LYS H  13      88.447  48.246  19.031  0.00 93.32           O
ATOM     86  CB  LYS H  13      89.204  48.604  15.955  0.00 93.33           C
ATOM     87  CG  LYS H  13      90.232  47.609  16.473  0.00 93.35           C
ATOM     88  CD  LYS H  13      90.770  46.727  15.355  0.00 93.36           C
ATOM     89  CE  LYS H  13      91.496  47.545  14.298  0.00 93.37           C
ATOM     90  NZ  LYS H  13      92.650  48.293  14.869  0.00 93.37           N
ATOM     91  N   ALA H  14      86.566  48.645  17.860  0.00 93.32           N
ATOM     92  CA  ALA H  14      85.702  47.911  18.777  0.00 93.32           C
ATOM     93  C   ALA H  14      85.303  46.561  18.189  0.00 93.33           C
ATOM     94  O   ALA H  14      84.229  46.421  17.604  0.00 93.33           O
ATOM     95  CB  ALA H  14      84.458  48.733  19.090  0.00 93.32           C
ATOM     96  N   VAL H  15      86.177  45.572  18.351  0.00 93.34           N
ATOM     97  CA  VAL H  15      85.929  44.227  17.842  0.00 93.35           C
ATOM     98  C   VAL H  15      85.648  44.248  16.342  0.00 93.38           C
ATOM     99  O   VAL H  15      86.573  44.263  15.529  0.00 93.37           O
ATOM    100  CB  VAL H  15      84.733  43.569  18.568  0.00 93.33           C
ATOM    101  CG1 VAL H  15      84.567  42.130  18.103  0.00 93.32           C
ATOM    102  CG2 VAL H  15      84.946  43.621  20.072  0.00 93.32           C
ATOM    103  N   THR H  16      84.368  44.248  15.980  0.00 93.42           N
ATOM    104  CA  THR H  16      83.968  44.266  14.579  0.00 93.48           C
ATOM    105  C   THR H  16      83.445  45.641  14.178  0.00 93.58           C
ATOM    106  O   THR H  16      83.175  46.486  15.031  0.00 93.56           O
ATOM    107  CB  THR H  16      82.869  43.222  14.300  0.00 93.43           C
ATOM    108  OG1 THR H  16      81.725  43.499  15.117  0.00 93.40           O
ATOM    109  CG2 THR H  16      83.377  41.821  14.604  0.00 93.40           C
ATOM    110  N   LYS H  17      83.305  45.856  12.874  0.00 93.72           N
ATOM    111  CA  LYS H  17      82.818  47.128  12.355  0.00 93.91           C
ATOM    112  C   LYS H  17      81.343  47.045  11.976  0.00 94.15           C
ATOM    113  O   LYS H  17      80.709  46.002  12.130  0.00 94.14           O
ATOM    114  CB  LYS H  17      83.641  47.547  11.135  0.00 93.75           C
ATOM    115  CG  LYS H  17      83.642  46.528  10.007  0.00 93.59           C
ATOM    116  CD  LYS H  17      84.485  47.003   8.835  0.00 93.46           C
ATOM    117  CE  LYS H  17      84.519  45.965   7.724  0.00 93.39           C
ATOM    118  NZ  LYS H  17      85.103  44.677   8.188  0.00 93.33           N
ATOM    119  N   THR H  18      80.806  48.155  11.479  1.00 94.59           N
ATOM    120  CA  THR H  18      79.407  48.222  11.073  1.00 94.62           C
ATOM    121  C   THR H  18      79.291  48.500   9.576  1.00 94.51           C
ATOM    122  O   THR H  18      79.969  49.379   9.045  1.00 93.79           O
ATOM    123  CB  THR H  18      78.656  49.339  11.832  1.00 95.25           C
ATOM    124  OG1 THR H  18      78.763  49.120  13.245  1.00 95.76           O
ATOM    125  CG2 THR H  18      77.187  49.351  11.435  1.00 95.20           C
ATOM    126  N   GLN H  19      78.430  47.742   8.905  1.00 94.81           N
ATOM    127  CA  GLN H  19      78.205  47.906   7.473  1.00 94.96           C
ATOM    128  C   GLN H  19      76.837  48.565   7.310  1.00 94.96           C
ATOM    129  O   GLN H  19      76.061  48.214   6.420  1.00 95.07           O
ATOM    130  CB  GLN H  19      78.222  46.539   6.775  1.00 95.41           C
ATOM    131  CG  GLN H  19      78.063  46.581   5.253  1.00 96.13           C
ATOM    132  CD  GLN H  19      79.367  46.836   4.518  1.00 96.79           C
ATOM    133  OE1 GLN H  19      80.299  46.035   4.588  1.00 97.49           O
ATOM    134  NE2 GLN H  19      79.437  47.953   3.802  1.00 97.71           N
ATOM    135  N   LYS H  20      76.548  49.522   8.187  1.00 94.37           N
ATOM    136  CA  LYS H  20      75.275  50.235   8.160  1.00 93.27           C
ATOM    137  C   LYS H  20      75.209  51.283   9.267  1.00 92.61           C
ATOM    138  O   LYS H  20      76.183  51.986   9.523  1.00 92.66           O
ATOM    139  CB  LYS H  20      74.120  49.243   8.318  1.00 93.31           C
ATOM    140  CG  LYS H  20      74.260  48.341   9.531  1.00 93.05           C
ATOM    141  CD  LYS H  20      73.141  47.324   9.604  1.00 92.93           C
ATOM    142  CE  LYS H  20      73.368  46.359  10.754  1.00 92.28           C
ATOM    143  NZ  LYS H  20      72.277  45.354  10.862  1.00 91.39           N
ATOM    144  N   LYS H  21      74.048  51.368   9.911  0.00 91.93           N
ATOM    145  CA  LYS H  21      73.774  52.303  11.003  0.00 91.23           C
ATOM    146  C   LYS H  21      74.928  53.210  11.419  0.00 90.85           C
ATOM    147  O   LYS H  21      75.158  54.257  10.813  0.00 90.78           O
ATOM    148  CB  LYS H  21      73.276  51.526  12.224  0.00 91.05           C
ATOM    149  CG  LYS H  21      72.033  50.693  11.960  0.00 90.80           C
ATOM    150  CD  LYS H  21      71.657  49.854  13.171  0.00 90.63           C
ATOM    151  CE  LYS H  21      72.749  48.851  13.512  0.00 90.51           C
ATOM    152  NZ  LYS H  21      72.391  48.024  14.697  0.00 90.44           N
ATOM    153  N   ASP H  22      75.643  52.799  12.463  0.00 90.46           N
ATOM    154  CA  ASP H  22      76.771  53.558  12.997  0.00 90.11           C
ATOM    155  C   ASP H  22      77.685  54.117  11.912  0.00 90.01           C
ATOM    156  O   ASP H  22      78.442  55.058  12.152  0.00 89.94           O
ATOM    157  CB  ASP H  22      77.584  52.678  13.948  0.00 89.86           C
ATOM    158  CG  ASP H  22      76.755  52.145  15.101  0.00 89.65           C
ATOM    159  OD1 ASP H  22      77.308  51.404  15.940  0.00 89.54           O
ATOM    160  OD2 ASP H  22      75.549  52.466  15.168  0.00 89.54           O
ATOM    161  N   GLY H  23      77.613  53.528  10.723  0.00 90.00           N
ATOM    162  CA  GLY H  23      78.431  53.982   9.614  0.00 90.09           C
ATOM    163  C   GLY H  23      78.420  55.490   9.473  0.00 90.20           C
ATOM    164  O   GLY H  23      79.477  56.121   9.475  0.00 90.13           O
ATOM    165  N   LYS H  24      77.229  56.072   9.354  1.00 90.57           N
ATOM    166  CA  LYS H  24      77.108  57.521   9.214  1.00 90.48           C
ATOM    167  C   LYS H  24      75.650  57.958   9.059  1.00 90.07           C
ATOM    168  O   LYS H  24      75.329  58.751   8.172  1.00 90.81           O
ATOM    169  CB  LYS H  24      77.925  57.985   8.002  1.00 90.48           C
ATOM    170  CG  LYS H  24      78.344  59.446   8.037  1.00 91.10           C
ATOM    171  CD  LYS H  24      79.220  59.804   6.841  1.00 91.07           C
ATOM    172  CE  LYS H  24      80.478  58.947   6.780  1.00 91.97           C
ATOM    173  NZ  LYS H  24      81.314  59.081   8.005  1.00 92.88           N
ATOM    174  N   LYS H  25      74.771  57.453   9.924  1.00 89.59           N
ATOM    175  CA  LYS H  25      73.346  57.797   9.859  1.00 88.87           C
ATOM    176  C   LYS H  25      72.837  58.565  11.079  1.00 88.21           C
ATOM    177  O   LYS H  25      71.708  59.058  11.082  1.00 89.55           O
ATOM    178  CB  LYS H  25      72.502  56.525   9.678  1.00 88.91           C
ATOM    179  CG  LYS H  25      72.462  55.585  10.889  1.00 88.60           C
ATOM    180  CD  LYS H  25      71.481  56.048  11.977  1.00 88.45           C
ATOM    181  CE  LYS H  25      70.033  55.977  11.500  1.00 88.53           C
ATOM    182  NZ  LYS H  25      69.041  56.351  12.546  1.00 89.19           N
ATOM    183  N   ARG H  26      73.663  58.655  12.113  1.00 86.67           N
ATOM    184  CA  ARG H  26      73.292  59.346  13.340  1.00 84.97           C
ATOM    185  C   ARG H  26      72.794  60.767  13.089  1.00 85.26           C
ATOM    186  O   ARG H  26      71.595  60.995  12.906  1.00 84.57           O
ATOM    187  CB  ARG H  26      74.488  59.382  14.287  1.00 84.36           C
ATOM    188  CG  ARG H  26      74.229  60.070  15.610  1.00 83.62           C
ATOM    189  CD  ARG H  26      75.528  60.208  16.371  1.00 83.37           C
ATOM    190  NE  ARG H  26      76.549  60.844  15.543  1.00 82.96           N
ATOM    191  CZ  ARG H  26      77.805  61.046  15.925  1.00 81.82           C
ATOM    192  NH1 ARG H  26      78.201  60.661  17.130  1.00 80.65           N
ATOM    193  NH2 ARG H  26      78.664  61.631  15.102  1.00 81.49           N
ATOM    194  N   ARG H  27      73.722  61.720  13.084  1.00 85.05           N
ATOM    195  CA  ARG H  27      73.392  63.124  12.863  1.00 83.62           C
ATOM    196  C   ARG H  27      72.858  63.287  11.452  1.00 82.19           C
ATOM    197  O   ARG H  27      72.834  64.388  10.897  1.00 81.34           O
ATOM    198  CB  ARG H  27      74.639  63.991  13.048  1.00 84.08           C
ATOM    199  CG  ARG H  27      75.388  63.721  14.342  1.00 84.49           C
ATOM    200  CD  ARG H  27      74.536  64.027  15.568  1.00 84.36           C
ATOM    201  NE  ARG H  27      74.584  62.935  16.536  1.00 84.77           N
ATOM    202  CZ  ARG H  27      74.113  63.003  17.778  1.00 84.61           C
ATOM    203  NH1 ARG H  27      73.555  64.121  18.221  1.00 84.55           N
ATOM    204  NH2 ARG H  27      74.196  61.945  18.576  1.00 84.99           N
ATOM    205  N   LYS H  28      72.422  62.174  10.878  1.00 80.36           N
ATOM    206  CA  LYS H  28      71.902  62.174   9.526  1.00 78.49           C
ATOM    207  C   LYS H  28      70.414  62.472   9.473  1.00 76.07           C
ATOM    208  O   LYS H  28      69.769  62.149   8.476  1.00 77.67           O
ATOM    209  CB  LYS H  28      72.172  60.824   8.856  1.00 79.29           C
ATOM    210  CG  LYS H  28      71.841  60.780   7.373  1.00 79.76           C
ATOM    211  CD  LYS H  28      71.451  59.374   6.945  1.00 80.40           C
ATOM    212  CE  LYS H  28      70.208  58.904   7.689  1.00 80.47           C
ATOM    213  NZ  LYS H  28      69.056  59.833   7.510  1.00 79.26           N
ATOM    214  N   THR H  29      69.852  63.070  10.523  1.00 71.85           N
ATOM    215  CA  THR H  29      68.425  63.383  10.471  1.00 67.65           C
ATOM    216  C   THR H  29      68.205  64.130   9.165  1.00 63.91           C
ATOM    217  O   THR H  29      68.516  65.316   9.056  1.00 61.36           O
ATOM    218  CB  THR H  29      67.962  64.283  11.627  1.00 69.08           C
ATOM    219  OG1 THR H  29      67.926  63.530  12.843  1.00 72.75           O
ATOM    220  CG2 THR H  29      66.567  64.810  11.350  1.00 70.71           C
ATOM    221  N   ARG H  30      67.689  63.413   8.174  1.00 61.13           N
ATOM    222  CA  ARG H  30      67.429  63.969   6.853  1.00 60.14           C
ATOM    223  C   ARG H  30      66.630  65.257   6.885  1.00 58.78           C
ATOM    224  O   ARG H  30      65.553  65.313   7.474  1.00 59.22           O
ATOM    225  CB  ARG H  30      66.661  62.969   5.992  1.00 59.56           C
ATOM    226  CG  ARG H  30      67.485  61.864   5.384  1.00 60.62           C
ATOM    227  CD  ARG H  30      66.579  60.893   4.643  1.00 64.02           C
ATOM    228  NE  ARG H  30      65.908  61.474   3.474  1.00 64.52           N
ATOM    229  CZ  ARG H  30      66.458  61.600   2.267  1.00 62.83           C
ATOM    230  NH1 ARG H  30      67.701  61.195   2.049  1.00 61.43           N
ATOM    231  NH2 ARG H  30      65.751  62.105   1.265  1.00 60.19           N
ATOM    232  N   LYS H  31      67.168  66.288   6.245  1.00 56.81           N
ATOM    233  CA  LYS H  31      66.485  67.572   6.147  1.00 55.90           C
ATOM    234  C   LYS H  31      66.346  67.799   4.643  1.00 52.48           C
ATOM    235  O   LYS H  31      67.282  68.236   3.998  1.00 51.99           O
ATOM    236  CB  LYS H  31      67.324  68.688   6.771  1.00 56.64           C
ATOM    237  CG  LYS H  31      66.567  69.994   6.984  1.00 59.36           C
ATOM    238  CD  LYS H  31      65.596  69.894   8.158  1.00 60.00           C
ATOM    239  CE  LYS H  31      64.832  71.188   8.352  1.00 62.37           C
ATOM    240  NZ  LYS H  31      63.970  71.505   7.171  1.00 62.07           N
ATOM    241  N   GLU H  32      65.185  67.475   4.088  1.00 49.36           N
ATOM    242  CA  GLU H  32      64.966  67.631   2.659  1.00 48.86           C
ATOM    243  C   GLU H  32      64.583  69.050   2.214  1.00 47.28           C
ATOM    244  O   GLU H  32      64.161  69.888   3.020  1.00 43.66           O
ATOM    245  CB  GLU H  32      63.904  66.638   2.191  1.00 52.50           C
ATOM    246  CG  GLU H  32      62.567  66.772   2.884  1.00 59.08           C
ATOM    247  CD  GLU H  32      61.587  65.693   2.455  1.00 63.53           C
ATOM    248  OE1 GLU H  32      62.055  64.605   2.049  1.00 61.67           O
ATOM    249  OE2 GLU H  32      60.356  65.927   2.542  1.00 64.62           O
ATOM    250  N   SER H  33      64.763  69.320   0.927  1.00 44.31           N
ATOM    251  CA  SER H  33      64.417  70.626   0.382  1.00 41.07           C
ATOM    252  C   SER H  33      64.215  70.492  -1.114  1.00 38.32           C
ATOM    253  O   SER H  33      64.437  69.424  -1.678  1.00 38.30           O
ATOM    254  CB  SER H  33      65.501  71.668   0.711  1.00 43.58           C
ATOM    255  OG  SER H  33      66.645  71.549  -0.101  1.00 41.67           O
ATOM    256  N   TYR H  34      63.764  71.558  -1.767  1.00 32.32           N
ATOM    257  CA  TYR H  34      63.535  71.480  -3.199  1.00 30.85           C
ATOM    258  C   TYR H  34      64.753  71.923  -3.988  1.00 29.58           C
ATOM    259  O   TYR H  34      64.708  71.986  -5.205  1.00 34.13           O
ATOM    260  CB  TYR H  34      62.340  72.352  -3.604  1.00 32.97           C
ATOM    261  CG  TYR H  34      61.011  71.850  -3.090  1.00 33.60           C
ATOM    262  CD1 TYR H  34      60.459  72.357  -1.914  1.00 34.19           C
ATOM    263  CD2 TYR H  34      60.277  70.901  -3.812  1.00 37.25           C
ATOM    264  CE1 TYR H  34      59.207  71.938  -1.478  1.00 32.83           C
ATOM    265  CE2 TYR H  34      59.027  70.480  -3.382  1.00 35.64           C
ATOM    266  CZ  TYR H  34      58.505  71.006  -2.213  1.00 34.43           C
ATOM    267  OH  TYR H  34      57.276  70.592  -1.794  1.00 37.58           O
ATOM    268  N   ALA H  35      65.846  72.204  -3.298  1.00 32.05           N
ATOM    269  CA  ALA H  35      67.048  72.687  -3.966  1.00 34.71           C
ATOM    270  C   ALA H  35      67.469  71.928  -5.229  1.00 37.75           C
ATOM    271  O   ALA H  35      67.678  72.557  -6.266  1.00 35.43           O
ATOM    272  CB  ALA H  35      68.214  72.757  -2.967  1.00 34.44           C
ATOM    273  N   ILE H  36      67.574  70.594  -5.193  1.00 37.95           N
ATOM    274  CA  ILE H  36      68.014  69.914  -6.419  1.00 38.83           C
ATOM    275  C   ILE H  36      66.998  69.970  -7.543  1.00 39.02           C
ATOM    276  O   ILE H  36      67.370  69.922  -8.713  1.00 38.87           O
ATOM    277  CB  ILE H  36      68.450  68.438  -6.179  1.00 42.11           C
ATOM    278  CG1 ILE H  36      67.258  67.557  -5.837  1.00 41.49           C
ATOM    279  CG2 ILE H  36      69.479  68.394  -5.052  1.00 43.48           C
ATOM    280  CD1 ILE H  36      67.663  66.079  -5.571  1.00 47.40           C
ATOM    281  N   TYR H  37      65.718  70.102  -7.214  1.00 36.62           N
ATOM    282  CA  TYR H  37      64.721  70.207  -8.268  1.00 35.73           C
ATOM    283  C   TYR H  37      64.694  71.644  -8.809  1.00 35.33           C
ATOM    284  O   TYR H  37      64.551  71.848 -10.005  1.00 38.03           O
ATOM    285  CB  TYR H  37      63.345  69.781  -7.755  1.00 36.88           C
ATOM    286  CG  TYR H  37      63.378  68.460  -7.015  1.00 41.03           C
ATOM    287  CD1 TYR H  37      63.366  68.424  -5.619  1.00 40.40           C
ATOM    288  CD2 TYR H  37      63.472  67.245  -7.710  1.00 40.77           C
ATOM    289  CE1 TYR H  37      63.451  67.220  -4.926  1.00 45.04           C
ATOM    290  CE2 TYR H  37      63.556  66.029  -7.026  1.00 44.00           C
ATOM    291  CZ  TYR H  37      63.548  66.024  -5.636  1.00 47.20           C
ATOM    292  OH  TYR H  37      63.638  64.840  -4.945  1.00 45.71           O
ATOM    293  N   VAL H  38      64.836  72.643  -7.939  1.00 34.56           N
ATOM    294  CA  VAL H  38      64.866  74.034  -8.402  1.00 33.16           C
ATOM    295  C   VAL H  38      66.075  74.176  -9.346  1.00 38.64           C
ATOM    296  O   VAL H  38      66.019  74.867 -10.358  1.00 37.88           O
ATOM    297  CB  VAL H  38      65.054  75.021  -7.224  1.00 31.61           C
ATOM    298  CG1 VAL H  38      65.342  76.415  -7.747  1.00 27.85           C
ATOM    299  CG2 VAL H  38      63.775  75.039  -6.330  1.00 27.26           C
ATOM    300  N   TYR H  39      67.173  73.521  -8.986  1.00 40.25           N
ATOM    301  CA  TYR H  39      68.388  73.569  -9.785  1.00 40.59           C
ATOM    302  C   TYR H  39      68.141  73.011 -11.184  1.00 38.66           C
ATOM    303  O   TYR H  39      68.584  73.591 -12.175  1.00 41.01           O
ATOM    304  CB  TYR H  39      69.504  72.764  -9.115  1.00 43.43           C
ATOM    305  CG  TYR H  39      70.847  73.105  -9.699  1.00 48.89           C
ATOM    306  CD1 TYR H  39      71.571  74.187  -9.216  1.00 52.86           C
ATOM    307  CD2 TYR H  39      71.358  72.399 -10.788  1.00 54.01           C
ATOM    308  CE1 TYR H  39      72.775  74.564  -9.797  1.00 58.55           C
ATOM    309  CE2 TYR H  39      72.570  72.774 -11.388  1.00 56.65           C
ATOM    310  CZ  TYR H  39      73.270  73.857 -10.879  1.00 57.72           C
ATOM    311  OH  TYR H  39      74.480  74.229 -11.421  1.00 63.30           O
ATOM    312  N   LYS H  40      67.429  71.890 -11.266  1.00 38.35           N
ATOM    313  CA  LYS H  40      67.125  71.276 -12.555  1.00 40.17           C
ATOM    314  C   LYS H  40      66.303  72.188 -13.448  1.00 41.12           C
ATOM    315  O   LYS H  40      66.521  72.238 -14.672  1.00 36.86           O
ATOM    316  CB  LYS H  40      66.360  69.966 -12.374  1.00 43.64           C
ATOM    317  CG  LYS H  40      67.206  68.797 -11.886  1.00 47.25           C
ATOM    318  CD  LYS H  40      66.323  67.578 -11.645  1.00 52.75           C
ATOM    319  CE  LYS H  40      67.134  66.389 -11.159  1.00 57.16           C
ATOM    320  NZ  LYS H  40      66.260  65.224 -10.851  1.00 59.71           N
ATOM    321  N   VAL H  41      65.348  72.905 -12.846  1.00 36.25           N
ATOM    322  CA  VAL H  41      64.500  73.809 -13.611  1.00 33.11           C
ATOM    323  C   VAL H  41      65.289  75.009 -14.092  1.00 35.19           C
ATOM    324  O   VAL H  41      65.047  75.511 -15.191  1.00 37.08           O
ATOM    325  CB  VAL H  41      63.281  74.299 -12.778  1.00 31.98           C
ATOM    326  CG1 VAL H  41      62.550  75.427 -13.509  1.00 34.28           C
ATOM    327  CG2 VAL H  41      62.342  73.140 -12.531  1.00 32.45           C
ATOM    328  N   LEU H  42      66.225  75.480 -13.277  1.00 34.91           N
ATOM    329  CA  LEU H  42      67.041  76.615 -13.677  1.00 39.89           C
ATOM    330  C   LEU H  42      67.837  76.262 -14.941  1.00 44.49           C
ATOM    331  O   LEU H  42      68.065  77.111 -15.809  1.00 43.46           O
ATOM    332  CB  LEU H  42      68.016  76.987 -12.561  1.00 37.96           C
ATOM    333  CG  LEU H  42      69.041  78.044 -12.947  1.00 39.42           C
ATOM    334  CD1 LEU H  42      68.366  79.364 -13.303  1.00 40.38           C
ATOM    335  CD2 LEU H  42      69.995  78.214 -11.809  1.00 37.45           C
ATOM    336  N   LYS H  43      68.268  75.008 -15.028  1.00 45.33           N
ATOM    337  CA  LYS H  43      69.039  74.555 -16.177  1.00 47.04           C
ATOM    338  C   LYS H  43      68.191  74.525 -17.438  1.00 49.84           C
ATOM    339  O   LYS H  43      68.683  74.822 -18.526  1.00 50.57           O
ATOM    340  CB  LYS H  43      69.628  73.171 -15.905  1.00 45.97           C
ATOM    341  CG  LYS H  43      70.565  73.118 -14.702  1.00 44.88           C
ATOM    342  CD  LYS H  43      71.849  73.934 -14.883  1.00 49.64           C
ATOM    343  CE  LYS H  43      71.666  75.424 -14.621  1.00 49.98           C
ATOM    344  NZ  LYS H  43      72.971  76.171 -14.601  1.00 50.32           N
ATOM    345  N   GLN H  44      66.917  74.176 -17.300  1.00 48.80           N
ATOM    346  CA  GLN H  44      66.047  74.141 -18.461  1.00 49.40           C
ATOM    347  C   GLN H  44      65.722  75.547 -18.955  1.00 48.42           C
ATOM    348  O   GLN H  44      65.562  75.753 -20.157  1.00 47.47           O
ATOM    349  CB  GLN H  44      64.755  73.393 -18.152  1.00 50.01           C
ATOM    350  CG  GLN H  44      64.944  71.952 -17.716  1.00 53.87           C
ATOM    351  CD  GLN H  44      63.611  71.230 -17.592  1.00 60.23           C
ATOM    352  OE1 GLN H  44      62.554  71.864 -17.590  1.00 61.97           O
ATOM    353  NE2 GLN H  44      63.652  69.904 -17.483  1.00 62.07           N
ATOM    354  N   VAL H  45      65.625  76.521 -18.046  1.00 46.53           N
ATOM    355  CA  VAL H  45      65.332  77.891 -18.483  1.00 45.37           C
ATOM    356  C   VAL H  45      66.583  78.756 -18.742  1.00 43.75           C
ATOM    357  O   VAL H  45      66.567  79.615 -19.619  1.00 44.97           O
ATOM    358  CB  VAL H  45      64.394  78.630 -17.481  1.00 43.65           C
ATOM    359  CG1 VAL H  45      63.229  77.732 -17.118  1.00 45.68           C
ATOM    360  CG2 VAL H  45      65.153  79.057 -16.241  1.00 41.67           C
ATOM    361  N   HIS H  46      67.653  78.544 -17.984  1.00 43.42           N
ATOM    362  CA  HIS H  46      68.882  79.314 -18.165  1.00 43.02           C
ATOM    363  C   HIS H  46      70.109  78.423 -17.982  1.00 42.42           C
ATOM    364  O   HIS H  46      70.825  78.522 -16.982  1.00 38.81           O
ATOM    365  CB  HIS H  46      68.953  80.480 -17.178  1.00 46.17           C
ATOM    366  CG  HIS H  46      67.966  81.572 -17.452  1.00 49.46           C
ATOM    367  ND1 HIS H  46      67.907  82.239 -18.656  1.00 46.53           N
ATOM    368  CD2 HIS H  46      67.007  82.122 -16.669  1.00 48.55           C
ATOM    369  CE1 HIS H  46      66.954  83.151 -18.605  1.00 50.23           C
ATOM    370  NE2 HIS H  46      66.392  83.100 -17.410  1.00 47.37           N
ATOM    371  N   PRO H  47      70.386  77.562 -18.977  1.00 44.61           N
ATOM    372  CA  PRO H  47      71.513  76.626 -18.973  1.00 43.67           C
ATOM    373  C   PRO H  47      72.850  77.136 -18.461  1.00 43.76           C
ATOM    374  O   PRO H  47      73.590  76.388 -17.834  1.00 44.87           O
ATOM    375  CB  PRO H  47      71.577  76.164 -20.428  1.00 47.20           C
ATOM    376  CG  PRO H  47      70.124  76.148 -20.820  1.00 46.23           C
ATOM    377  CD  PRO H  47      69.628  77.463 -20.241  1.00 44.23           C
ATOM    378  N   ASP H  48      73.154  78.406 -18.693  1.00 43.34           N
ATOM    379  CA  ASP H  48      74.429  78.951 -18.258  1.00 46.16           C
ATOM    380  C   ASP H  48      74.388  79.875 -17.036  1.00 45.32           C
ATOM    381  O   ASP H  48      75.322  80.637 -16.774  1.00 43.46           O
ATOM    382  CB  ASP H  48      75.072  79.644 -19.453  1.00 49.10           C
ATOM    383  CG  ASP H  48      75.136  78.726 -20.663  1.00 52.24           C
ATOM    384  OD1 ASP H  48      75.681  77.618 -20.515  1.00 54.18           O
ATOM    385  OD2 ASP H  48      74.628  79.091 -21.745  1.00 55.19           O
ATOM    386  N   THR H  49      73.315  79.761 -16.261  1.00 43.61           N
ATOM    387  CA  THR H  49      73.142  80.589 -15.082  1.00 39.04           C
ATOM    388  C   THR H  49      73.199  79.766 -13.814  1.00 34.43           C
ATOM    389  O   THR H  49      72.698  78.663 -13.759  1.00 34.09           O
ATOM    390  CB  THR H  49      71.791  81.358 -15.178  1.00 41.53           C
ATOM    391  OG1 THR H  49      71.781  82.114 -16.399  1.00 37.41           O
ATOM    392  CG2 THR H  49      71.617  82.320 -14.014  1.00 38.11           C
ATOM    393  N   GLY H  50      73.859  80.300 -12.801  1.00 34.21           N
ATOM    394  CA  GLY H  50      73.943  79.594 -11.543  1.00 37.44           C
ATOM    395  C   GLY H  50      73.002  80.266 -10.555  1.00 36.51           C
ATOM    396  O   GLY H  50      72.204  81.117 -10.946  1.00 33.91           O
ATOM    397  N   ILE H  51      73.097  79.890  -9.286  1.00 36.51           N
ATOM    398  CA  ILE H  51      72.257  80.472  -8.244  1.00 32.29           C
ATOM    399  C   ILE H  51      73.009  80.312  -6.950  1.00 33.87           C
ATOM    400  O   ILE H  51      73.534  79.244  -6.660  1.00 34.59           O
ATOM    401  CB  ILE H  51      70.855  79.773  -8.182  1.00 35.47           C
ATOM    402  CG1 ILE H  51      69.961  80.471  -7.145  1.00 28.35           C
ATOM    403  CG2 ILE H  51      71.006  78.257  -7.886  1.00 33.54           C
ATOM    404  CD1 ILE H  51      68.522  80.011  -7.206  1.00 30.79           C
ATOM    405  N   SER H  52      73.099  81.393  -6.191  1.00 30.37           N
ATOM    406  CA  SER H  52      73.796  81.382  -4.927  1.00 31.06           C
ATOM    407  C   SER H  52      73.016  80.564  -3.910  1.00 33.32           C
ATOM    408  O   SER H  52      71.845  80.243  -4.126  1.00 29.82           O
ATOM    409  CB  SER H  52      73.963  82.807  -4.419  1.00 31.94           C
ATOM    410  OG  SER H  52      72.723  83.291  -3.907  1.00 36.05           O
ATOM    411  N   SER H  53      73.671  80.211  -2.807  1.00 35.27           N
ATOM    412  CA  SER H  53      73.020  79.429  -1.760  1.00 35.04           C
ATOM    413  C   SER H  53      71.887  80.214  -1.103  1.00 33.63           C
ATOM    414  O   SER H  53      70.821  79.647  -0.819  1.00 30.93           O
ATOM    415  CB  SER H  53      74.037  79.006  -0.699  1.00 35.17           C
ATOM    416  OG  SER H  53      74.835  77.950  -1.197  1.00 48.22           O
ATOM    417  N   LYS H  54      72.145  81.491  -0.830  1.00 33.86           N
ATOM    418  CA  LYS H  54      71.142  82.372  -0.228  1.00 34.86           C
ATOM    419  C   LYS H  54      69.956  82.461  -1.185  1.00 32.40           C
ATOM    420  O   LYS H  54      68.820  82.416  -0.752  1.00 32.93           O
ATOM    421  CB  LYS H  54      71.713  83.773   0.014  1.00 38.85           C
ATOM    422  CG  LYS H  54      72.688  83.875   1.177  1.00 46.87           C
ATOM    423  CD  LYS H  54      73.399  85.232   1.173  1.00 50.75           C
ATOM    424  CE  LYS H  54      74.300  85.413   2.392  1.00 56.65           C
ATOM    425  NZ  LYS H  54      73.502  85.639   3.638  1.00 58.97           N
ATOM    426  N   ALA H  55      70.208  82.570  -2.493  1.00 29.79           N
ATOM    427  CA  ALA H  55      69.096  82.641  -3.437  1.00 25.45           C
ATOM    428  C   ALA H  55      68.339  81.343  -3.494  1.00 28.27           C
ATOM    429  O   ALA H  55      67.103  81.341  -3.644  1.00 24.28           O
ATOM    430  CB  ALA H  55      69.572  83.018  -4.847  1.00 29.72           C
ATOM    431  N   MET H  56      69.060  80.225  -3.402  1.00 26.58           N
ATOM    432  CA  MET H  56      68.400  78.924  -3.436  1.00 25.69           C
ATOM    433  C   MET H  56      67.503  78.743  -2.199  1.00 24.94           C
ATOM    434  O   MET H  56      66.463  78.094  -2.272  1.00 24.89           O
ATOM    435  CB  MET H  56      69.441  77.789  -3.475  1.00 28.89           C
ATOM    436  CG  MET H  56      68.802  76.423  -3.468  1.00 25.91           C
ATOM    437  SD  MET H  56      67.752  76.133  -4.870  1.00 32.25           S
ATOM    438  CE  MET H  56      69.043  75.447  -6.087  1.00 31.95           C
ATOM    439  N   SER H  57      67.925  79.293  -1.065  1.00 25.70           N
ATOM    440  CA  SER H  57      67.122  79.184   0.156  1.00 29.71           C
ATOM    441  C   SER H  57      65.829  80.007  -0.014  1.00 29.67           C
ATOM    442  O   SER H  57      64.763  79.604   0.458  1.00 28.38           O
ATOM    443  CB  SER H  57      67.917  79.684   1.353  1.00 31.21           C
ATOM    444  OG  SER H  57      67.192  79.432   2.534  1.00 40.06           O
ATOM    445  N   ILE H  58      65.932  81.146  -0.696  1.00 28.14           N
ATOM    446  CA  ILE H  58      64.746  81.965  -0.988  1.00 29.34           C
ATOM    447  C   ILE H  58      63.814  81.088  -1.823  1.00 25.68           C
ATOM    448  O   ILE H  58      62.601  81.008  -1.563  1.00 24.82           O
ATOM    449  CB  ILE H  58      65.066  83.193  -1.872  1.00 27.46           C
ATOM    450  CG1 ILE H  58      66.053  84.139  -1.180  1.00 30.43           C
ATOM    451  CG2 ILE H  58      63.733  83.886  -2.273  1.00 27.61           C
ATOM    452  CD1 ILE H  58      65.622  84.673   0.152  1.00 36.15           C
ATOM    453  N   MET H  59      64.365  80.425  -2.852  1.00 26.38           N
ATOM    454  CA  MET H  59      63.537  79.552  -3.692  1.00 24.96           C
ATOM    455  C   MET H  59      62.902  78.414  -2.909  1.00 26.01           C
ATOM    456  O   MET H  59      61.747  78.075  -3.145  1.00 26.11           O
ATOM    457  CB  MET H  59      64.330  78.954  -4.881  1.00 26.11           C
ATOM    458  CG  MET H  59      64.726  79.988  -5.942  1.00 29.68           C
ATOM    459  SD  MET H  59      63.348  80.952  -6.603  1.00 30.60           S
ATOM    460  CE  MET H  59      62.434  79.736  -7.389  1.00 26.37           C
ATOM    461  N   ASN H  60      63.658  77.798  -1.998  1.00 28.11           N
ATOM    462  CA  ASN H  60      63.098  76.710  -1.208  1.00 28.08           C
ATOM    463  C   ASN H  60      61.904  77.261  -0.389  1.00 26.47           C
ATOM    464  O   ASN H  60      60.857  76.630  -0.325  1.00 27.25           O
ATOM    465  CB  ASN H  60      64.157  76.131  -0.265  1.00 30.67           C
ATOM    466  CG  ASN H  60      63.717  74.811   0.356  1.00 34.29           C
ATOM    467  OD1 ASN H  60      63.260  73.925  -0.344  1.00 33.66           O
ATOM    468  ND2 ASN H  60      63.856  74.684   1.669  1.00 35.02           N
ATOM    469  N   SER H  61      62.085  78.427   0.237  1.00 25.03           N
ATOM    470  CA  SER H  61      61.013  79.066   1.018  1.00 26.07           C
ATOM    471  C   SER H  61      59.809  79.329   0.107  1.00 24.27           C
ATOM    472  O   SER H  61      58.650  79.124   0.495  1.00 23.36           O
ATOM    473  CB  SER H  61      61.468  80.404   1.586  1.00 22.60           C
ATOM    474  OG  SER H  61      62.424  80.276   2.604  1.00 27.00           O
ATOM    475  N   PHE H  62      60.082  79.816  -1.096  1.00 24.18           N
ATOM    476  CA  PHE H  62      59.015  80.074  -2.075  1.00 23.18           C
ATOM    477  C   PHE H  62      58.162  78.852  -2.400  1.00 25.44           C
ATOM    478  O   PHE H  62      56.913  78.876  -2.366  1.00 21.96           O
ATOM    479  CB  PHE H  62      59.596  80.580  -3.399  1.00 22.14           C
ATOM    480  CG  PHE H  62      58.550  80.727  -4.496  1.00 23.23           C
ATOM    481  CD1 PHE H  62      57.531  81.683  -4.384  1.00 25.81           C
ATOM    482  CD2 PHE H  62      58.583  79.909  -5.625  1.00 27.56           C
ATOM    483  CE1 PHE H  62      56.554  81.817  -5.392  1.00 29.75           C
ATOM    484  CE2 PHE H  62      57.620  80.023  -6.645  1.00 30.49           C
ATOM    485  CZ  PHE H  62      56.601  80.980  -6.533  1.00 29.43           C
ATOM    486  N   VAL H  63      58.827  77.761  -2.756  1.00 24.92           N
ATOM    487  CA  VAL H  63      58.089  76.572  -3.110  1.00 20.62           C
ATOM    488  C   VAL H  63      57.308  76.053  -1.891  1.00 22.86           C
ATOM    489  O   VAL H  63      56.170  75.621  -2.027  1.00 25.64           O
ATOM    490  CB  VAL H  63      59.039  75.444  -3.642  1.00 25.03           C
ATOM    491  CG1 VAL H  63      58.220  74.189  -3.972  1.00 25.59           C
ATOM    492  CG2 VAL H  63      59.761  75.920  -4.905  1.00 24.29           C
ATOM    493  N   ASN H  64      57.924  76.094  -0.718  1.00 21.41           N
ATOM    494  CA  ASN H  64      57.255  75.624   0.494  1.00 25.30           C
ATOM    495  C   ASN H  64      56.031  76.479   0.803  1.00 23.86           C
ATOM    496  O   ASN H  64      55.008  75.975   1.239  1.00 23.52           O
ATOM    497  CB  ASN H  64      58.210  75.652   1.681  1.00 26.85           C
ATOM    498  CG  ASN H  64      59.110  74.405   1.741  1.00 32.48           C
ATOM    499  OD1 ASN H  64      58.648  73.290   1.536  1.00 34.95           O
ATOM    500  ND2 ASN H  64      60.382  74.600   2.031  1.00 34.78           N
ATOM    501  N   ASP H  65      56.165  77.777   0.582  1.00 26.19           N
ATOM    502  CA  ASP H  65      55.076  78.723   0.849  1.00 25.05           C
ATOM    503  C   ASP H  65      53.898  78.451  -0.087  1.00 24.06           C
ATOM    504  O   ASP H  65      52.759  78.267   0.352  1.00 26.03           O
ATOM    505  CB  ASP H  65      55.626  80.150   0.684  1.00 21.21           C
ATOM    506  CG  ASP H  65      54.610  81.217   1.068  1.00 29.40           C
ATOM    507  OD1 ASP H  65      53.818  80.956   1.990  1.00 33.72           O
ATOM    508  OD2 ASP H  65      54.620  82.302   0.462  1.00 26.30           O
ATOM    509  N   VAL H  66      54.159  78.386  -1.385  1.00 23.09           N
ATOM    510  CA  VAL H  66      53.088  78.132  -2.327  1.00 23.53           C
ATOM    511  C   VAL H  66      52.425  76.779  -2.134  1.00 26.47           C
ATOM    512  O   VAL H  66      51.219  76.623  -2.343  1.00 21.23           O
ATOM    513  CB  VAL H  66      53.577  78.256  -3.771  1.00 28.60           C
ATOM    514  CG1 VAL H  66      52.450  77.870  -4.721  1.00 33.07           C
ATOM    515  CG2 VAL H  66      54.012  79.658  -4.029  1.00 32.11           C
ATOM    516  N   PHE H  67      53.227  75.785  -1.767  1.00 25.85           N
ATOM    517  CA  PHE H  67      52.694  74.455  -1.492  1.00 25.81           C
ATOM    518  C   PHE H  67      51.678  74.579  -0.339  1.00 21.55           C
ATOM    519  O   PHE H  67      50.557  74.097  -0.424  1.00 23.46           O
ATOM    520  CB  PHE H  67      53.828  73.532  -1.055  1.00 25.62           C
ATOM    521  CG  PHE H  67      53.361  72.177  -0.636  1.00 30.03           C
ATOM    522  CD1 PHE H  67      53.361  71.124  -1.536  1.00 31.09           C
ATOM    523  CD2 PHE H  67      52.865  71.966   0.647  1.00 29.56           C
ATOM    524  CE1 PHE H  67      52.862  69.873  -1.164  1.00 34.71           C
ATOM    525  CE2 PHE H  67      52.368  70.721   1.019  1.00 33.74           C
ATOM    526  CZ  PHE H  67      52.368  69.677   0.102  1.00 29.26           C
ATOM    527  N   GLU H  68      52.090  75.212   0.745  1.00 24.83           N
ATOM    528  CA  GLU H  68      51.204  75.383   1.903  1.00 24.33           C
ATOM    529  C   GLU H  68      49.929  76.172   1.562  1.00 23.69           C
ATOM    530  O   GLU H  68      48.833  75.785   1.941  1.00 21.78           O
ATOM    531  CB  GLU H  68      51.953  76.087   3.030  1.00 28.12           C
ATOM    532  CG  GLU H  68      53.061  75.238   3.640  1.00 37.03           C
ATOM    533  CD  GLU H  68      53.911  76.010   4.630  1.00 43.06           C
ATOM    534  OE1 GLU H  68      53.855  77.261   4.622  1.00 47.14           O
ATOM    535  OE2 GLU H  68      54.650  75.367   5.403  1.00 47.11           O
ATOM    536  N   ARG H  69      50.064  77.267   0.838  1.00 22.00           N
ATOM    537  CA  ARG H  69      48.870  78.038   0.477  1.00 24.45           C
ATOM    538  C   ARG H  69      47.927  77.246  -0.419  1.00 25.08           C
ATOM    539  O   ARG H  69      46.701  77.281  -0.270  1.00 23.32           O
ATOM    540  CB  ARG H  69      49.257  79.293  -0.270  1.00 25.46           C
ATOM    541  CG  ARG H  69      50.106  80.267   0.500  1.00 27.79           C
ATOM    542  CD  ARG H  69      50.003  81.608  -0.203  1.00 36.30           C
ATOM    543  NE  ARG H  69      51.284  82.270  -0.326  1.00 36.39           N
ATOM    544  CZ  ARG H  69      51.453  83.413  -0.973  1.00 32.20           C
ATOM    545  NH1 ARG H  69      50.412  84.022  -1.552  1.00 25.33           N
ATOM    546  NH2 ARG H  69      52.651  83.953  -1.006  1.00 28.86           N
ATOM    547  N   ILE H  70      48.482  76.551  -1.395  1.00 25.82           N
ATOM    548  CA  ILE H  70      47.606  75.802  -2.300  1.00 25.12           C
ATOM    549  C   ILE H  70      46.976  74.616  -1.584  1.00 26.75           C
ATOM    550  O   ILE H  70      45.784  74.347  -1.748  1.00 26.59           O
ATOM    551  CB  ILE H  70      48.378  75.317  -3.558  1.00 28.58           C
ATOM    552  CG1 ILE H  70      48.638  76.518  -4.494  1.00 22.82           C
ATOM    553  CG2 ILE H  70      47.575  74.251  -4.307  1.00 27.92           C
ATOM    554  CD1 ILE H  70      49.631  76.192  -5.642  1.00 28.50           C
ATOM    555  N   ALA H  71      47.773  73.913  -0.784  1.00 25.40           N
ATOM    556  CA  ALA H  71      47.260  72.764  -0.038  1.00 27.15           C
ATOM    557  C   ALA H  71      46.230  73.205   1.011  1.00 27.82           C
ATOM    558  O   ALA H  71      45.223  72.519   1.251  1.00 25.37           O
ATOM    559  CB  ALA H  71      48.426  72.025   0.641  1.00 27.12           C
ATOM    560  N   GLY H  72      46.490  74.344   1.647  1.00 28.37           N
ATOM    561  CA  GLY H  72      45.570  74.847   2.655  1.00 28.52           C
ATOM    562  C   GLY H  72      44.240  75.217   2.022  1.00 27.97           C
ATOM    563  O   GLY H  72      43.174  74.934   2.570  1.00 29.49           O
ATOM    564  N   GLU H  73      44.305  75.869   0.866  1.00 29.09           N
ATOM    565  CA  GLU H  73      43.099  76.264   0.135  1.00 28.38           C
ATOM    566  C   GLU H  73      42.356  75.010  -0.335  1.00 28.18           C
ATOM    567  O   GLU H  73      41.126  74.950  -0.284  1.00 27.77           O
ATOM    568  CB  GLU H  73      43.483  77.121  -1.067  1.00 28.53           C
ATOM    569  CG  GLU H  73      42.370  77.957  -1.650  1.00 40.41           C
ATOM    570  CD  GLU H  73      42.142  79.245  -0.853  1.00 44.81           C
ATOM    571  OE1 GLU H  73      41.005  79.430  -0.378  1.00 43.26           O
ATOM    572  OE2 GLU H  73      43.097  80.062  -0.699  1.00 40.62           O
ATOM    573  N   ALA H  74      43.096  73.991  -0.767  1.00 24.90           N
ATOM    574  CA  ALA H  74      42.465  72.746  -1.244  1.00 21.08           C
ATOM    575  C   ALA H  74      41.771  72.056  -0.098  1.00 26.50           C
ATOM    576  O   ALA H  74      40.679  71.502  -0.262  1.00 26.85           O
ATOM    577  CB  ALA H  74      43.521  71.816  -1.860  1.00 24.01           C
ATOM    578  N   SER H  75      42.429  72.079   1.063  1.00 26.25           N
ATOM    579  CA  SER H  75      41.887  71.514   2.282  1.00 27.66           C
ATOM    580  C   SER H  75      40.524  72.137   2.672  1.00 28.73           C
ATOM    581  O   SER H  75      39.554  71.430   2.937  1.00 26.62           O
ATOM    582  CB  SER H  75      42.894  71.730   3.417  1.00 28.28           C
ATOM    583  OG  SER H  75      42.457  71.116   4.610  1.00 33.56           O
ATOM    584  N   ARG H  76      40.468  73.466   2.722  1.00 26.96           N
ATOM    585  CA  ARG H  76      39.251  74.168   3.072  1.00 27.91           C
ATOM    586  C   ARG H  76      38.155  73.874   2.045  1.00 30.87           C
ATOM    587  O   ARG H  76      37.011  73.641   2.404  1.00 32.65           O
ATOM    588  CB  ARG H  76      39.546  75.678   3.168  1.00 28.27           C
ATOM    589  CG  ARG H  76      40.606  76.032   4.225  1.00 30.69           C
ATOM    590  CD  ARG H  76      40.998  77.536   4.180  1.00 39.30           C
ATOM    591  NE  ARG H  76      42.426  77.681   4.446  1.00 46.28           N
ATOM    592  CZ  ARG H  76      43.292  78.212   3.599  1.00 44.08           C
ATOM    593  NH1 ARG H  76      42.893  78.662   2.426  1.00 45.21           N
ATOM    594  NH2 ARG H  76      44.569  78.278   3.927  1.00 54.84           N
ATOM    595  N   LEU H  77      38.507  73.887   0.759  1.00 29.47           N
ATOM    596  CA  LEU H  77      37.559  73.582  -0.286  1.00 27.43           C
ATOM    597  C   LEU H  77      36.881  72.231  -0.064  1.00 30.20           C
ATOM    598  O   LEU H  77      35.666  72.113  -0.162  1.00 30.72           O
ATOM    599  CB  LEU H  77      38.264  73.523  -1.643  1.00 30.19           C
ATOM    600  CG  LEU H  77      38.095  74.589  -2.714  1.00 34.33           C
ATOM    601  CD1 LEU H  77      38.735  74.039  -3.986  1.00 36.23           C
ATOM    602  CD2 LEU H  77      36.595  74.912  -2.958  1.00 34.13           C
ATOM    603  N   ALA H  78      37.680  71.198   0.182  1.00 29.72           N
ATOM    604  CA  ALA H  78      37.140  69.861   0.407  1.00 29.70           C
ATOM    605  C   ALA H  78      36.289  69.846   1.653  1.00 31.15           C
ATOM    606  O   ALA H  78      35.231  69.216   1.667  1.00 34.45           O
ATOM    607  CB  ALA H  78      38.275  68.826   0.559  1.00 25.21           C
ATOM    608  N   HIS H  79      36.754  70.506   2.713  1.00 30.49           N
ATOM    609  CA  HIS H  79      35.980  70.534   3.965  1.00 33.30           C
ATOM    610  C   HIS H  79      34.643  71.225   3.748  1.00 33.60           C
ATOM    611  O   HIS H  79      33.612  70.724   4.186  1.00 34.25           O
ATOM    612  CB  HIS H  79      36.758  71.238   5.076  1.00 36.04           C
ATOM    613  CG  HIS H  79      37.762  70.353   5.757  1.00 43.71           C
ATOM    614  ND1 HIS H  79      39.059  70.749   6.016  1.00 47.84           N
ATOM    615  CD2 HIS H  79      37.656  69.088   6.229  1.00 46.88           C
ATOM    616  CE1 HIS H  79      39.707  69.765   6.616  1.00 48.39           C
ATOM    617  NE2 HIS H  79      38.878  68.745   6.758  1.00 51.30           N
ATOM    618  N   TYR H  80      34.668  72.368   3.064  1.00 32.87           N
ATOM    619  CA  TYR H  80      33.447  73.110   2.771  1.00 37.07           C
ATOM    620  C   TYR H  80      32.445  72.230   2.028  1.00 36.63           C
ATOM    621  O   TYR H  80      31.239  72.333   2.228  1.00 36.17           O
ATOM    622  CB  TYR H  80      33.735  74.339   1.890  1.00 37.81           C
ATOM    623  CG  TYR H  80      34.631  75.385   2.531  1.00 36.93           C
ATOM    624  CD1 TYR H  80      34.749  75.484   3.916  1.00 37.07           C
ATOM    625  CD2 TYR H  80      35.303  76.319   1.743  1.00 37.99           C
ATOM    626  CE1 TYR H  80      35.514  76.498   4.497  1.00 40.22           C
ATOM    627  CE2 TYR H  80      36.065  77.324   2.307  1.00 34.76           C
ATOM    628  CZ  TYR H  80      36.170  77.412   3.685  1.00 40.00           C
ATOM    629  OH  TYR H  80      36.927  78.424   4.244  1.00 39.77           O
ATOM    630  N   ASN H  81      32.942  71.375   1.147  1.00 36.48           N
ATOM    631  CA  ASN H  81      32.049  70.518   0.388  1.00 37.55           C
ATOM    632  C   ASN H  81      31.800  69.150   1.017  1.00 37.40           C
ATOM    633  O   ASN H  81      31.209  68.280   0.396  1.00 38.77           O
ATOM    634  CB  ASN H  81      32.591  70.392  -1.031  1.00 34.70           C
ATOM    635  CG  ASN H  81      32.380  71.659  -1.805  1.00 36.68           C
ATOM    636  OD1 ASN H  81      31.259  71.956  -2.202  1.00 35.04           O
ATOM    637  ND2 ASN H  81      33.442  72.446  -1.981  1.00 38.10           N
ATOM    638  N   LYS H  82      32.255  68.972   2.248  1.00 36.76           N
ATOM    639  CA  LYS H  82      32.060  67.715   2.953  1.00 42.60           C
ATOM    640  C   LYS H  82      32.653  66.558   2.169  1.00 42.80           C
ATOM    641  O   LYS H  82      31.983  65.557   1.927  1.00 42.39           O
ATOM    642  CB  LYS H  82      30.557  67.488   3.180  1.00 44.63           C
ATOM    643  CG  LYS H  82      29.885  68.654   3.910  1.00 49.25           C
ATOM    644  CD  LYS H  82      28.361  68.548   3.895  1.00 52.81           C
ATOM    645  CE  LYS H  82      27.719  69.576   4.826  1.00 53.05           C
ATOM    646  NZ  LYS H  82      28.043  70.991   4.465  1.00 57.73           N
ATOM    647  N   ARG H  83      33.908  66.714   1.759  1.00 41.61           N
ATOM    648  CA  ARG H  83      34.623  65.685   1.012  1.00 39.94           C
ATOM    649  C   ARG H  83      35.868  65.361   1.807  1.00 40.78           C
ATOM    650  O   ARG H  83      36.564  66.265   2.272  1.00 40.13           O
ATOM    651  CB  ARG H  83      35.059  66.181  -0.377  1.00 43.12           C
ATOM    652  CG  ARG H  83      33.927  66.509  -1.335  1.00 45.06           C
ATOM    653  CD  ARG H  83      32.985  65.342  -1.463  1.00 51.24           C
ATOM    654  NE  ARG H  83      31.884  65.615  -2.377  1.00 55.35           N
ATOM    655  CZ  ARG H  83      30.675  65.079  -2.249  1.00 60.97           C
ATOM    656  NH1 ARG H  83      30.421  64.250  -1.244  1.00 62.44           N
ATOM    657  NH2 ARG H  83      29.720  65.364  -3.127  1.00 65.00           N
ATOM    658  N   SER H  84      36.173  64.080   1.956  1.00 38.14           N
ATOM    659  CA  SER H  84      37.353  63.727   2.715  1.00 39.72           C
ATOM    660  C   SER H  84      38.566  63.559   1.836  1.00 34.99           C
ATOM    661  O   SER H  84      39.632  63.262   2.334  1.00 37.44           O
ATOM    662  CB  SER H  84      37.107  62.449   3.531  1.00 42.06           C
ATOM    663  OG  SER H  84      36.663  61.397   2.709  1.00 46.72           O
ATOM    664  N   THR H  85      38.411  63.799   0.537  1.00 34.57           N
ATOM    665  CA  THR H  85      39.499  63.635  -0.429  1.00 35.35           C
ATOM    666  C   THR H  85      39.933  64.907  -1.174  1.00 34.30           C
ATOM    667  O   THR H  85      39.097  65.679  -1.647  1.00 36.42           O
ATOM    668  CB  THR H  85      39.119  62.617  -1.535  1.00 37.66           C
ATOM    669  OG1 THR H  85      38.627  61.415  -0.939  1.00 36.45           O
ATOM    670  CG2 THR H  85      40.347  62.273  -2.400  1.00 34.87           C
ATOM    671  N   ILE H  86      41.241  65.133  -1.235  1.00 32.36           N
ATOM    672  CA  ILE H  86      41.770  66.257  -1.999  1.00 31.23           C
ATOM    673  C   ILE H  86      42.227  65.608  -3.309  1.00 35.26           C
ATOM    674  O   ILE H  86      43.142  64.763  -3.337  1.00 33.07           O
ATOM    675  CB  ILE H  86      42.957  66.917  -1.307  1.00 30.31           C
ATOM    676  CG1 ILE H  86      42.446  67.773  -0.130  1.00 31.25           C
ATOM    677  CG2 ILE H  86      43.741  67.778  -2.322  1.00 29.46           C
ATOM    678  CD1 ILE H  86      43.542  68.247   0.776  1.00 31.33           C
ATOM    679  N   THR H  87      41.544  65.983  -4.376  1.00 32.31           N
ATOM    680  CA  THR H  87      41.823  65.483  -5.706  1.00 36.59           C
ATOM    681  C   THR H  87      42.426  66.614  -6.544  1.00 35.93           C
ATOM    682  O   THR H  87      42.577  67.738  -6.070  1.00 31.36           O
ATOM    683  CB  THR H  87      40.525  65.016  -6.391  1.00 37.74           C
ATOM    684  OG1 THR H  87      39.772  66.159  -6.792  1.00 36.48           O
ATOM    685  CG2 THR H  87      39.673  64.169  -5.431  1.00 38.42           C
ATOM    686  N   SER H  88      42.760  66.323  -7.791  1.00 32.58           N
ATOM    687  CA  SER H  88      43.327  67.340  -8.674  1.00 32.59           C
ATOM    688  C   SER H  88      42.320  68.482  -8.894  1.00 31.77           C
ATOM    689  O   SER H  88      42.705  69.619  -9.128  1.00 30.32           O
ATOM    690  CB  SER H  88      43.732  66.707 -10.022  1.00 34.31           C
ATOM    691  OG  SER H  88      42.608  66.113 -10.639  1.00 37.99           O
ATOM    692  N   ARG H  89      41.035  68.181  -8.809  1.00 30.14           N
ATOM    693  CA  ARG H  89      40.009  69.210  -8.965  1.00 31.52           C
ATOM    694  C   ARG H  89      40.111  70.295  -7.857  1.00 31.14           C
ATOM    695  O   ARG H  89      39.922  71.476  -8.128  1.00 29.10           O
ATOM    696  CB  ARG H  89      38.629  68.550  -8.929  1.00 35.81           C
ATOM    697  CG  ARG H  89      37.491  69.466  -9.360  1.00 43.33           C
ATOM    698  CD  ARG H  89      36.279  68.660  -9.836  1.00 47.99           C
ATOM    699  NE  ARG H  89      35.131  69.521 -10.099  1.00 51.98           N
ATOM    700  CZ  ARG H  89      34.450  70.145  -9.148  1.00 50.83           C
ATOM    701  NH1 ARG H  89      34.805  69.992  -7.889  1.00 54.59           N
ATOM    702  NH2 ARG H  89      33.428  70.926  -9.454  1.00 52.02           N
ATOM    703  N   GLU H  90      40.389  69.888  -6.617  1.00 31.43           N
ATOM    704  CA  GLU H  90      40.547  70.845  -5.519  1.00 31.00           C
ATOM    705  C   GLU H  90      41.831  71.634  -5.697  1.00 28.70           C
ATOM    706  O   GLU H  90      41.891  72.820  -5.375  1.00 27.96           O
ATOM    707  CB  GLU H  90      40.560  70.141  -4.158  1.00 29.72           C
ATOM    708  CG  GLU H  90      39.189  69.754  -3.669  1.00 34.83           C
ATOM    709  CD  GLU H  90      38.568  68.690  -4.545  1.00 40.01           C
ATOM    710  OE1 GLU H  90      39.297  67.744  -4.898  1.00 36.57           O
ATOM    711  OE2 GLU H  90      37.370  68.795  -4.872  1.00 39.78           O
ATOM    712  N   ILE H  91      42.868  70.990  -6.222  1.00 27.41           N
ATOM    713  CA  ILE H  91      44.126  71.680  -6.443  1.00 26.31           C
ATOM    714  C   ILE H  91      43.904  72.743  -7.499  1.00 27.31           C
ATOM    715  O   ILE H  91      44.380  73.882  -7.354  1.00 25.01           O
ATOM    716  CB  ILE H  91      45.235  70.724  -6.925  1.00 28.17           C
ATOM    717  CG1 ILE H  91      45.539  69.682  -5.835  1.00 28.98           C
ATOM    718  CG2 ILE H  91      46.493  71.514  -7.247  1.00 26.54           C
ATOM    719  CD1 ILE H  91      46.014  70.278  -4.503  1.00 25.99           C
ATOM    720  N   GLN H  92      43.150  72.384  -8.537  1.00 25.42           N
ATOM    721  CA  GLN H  92      42.872  73.297  -9.643  1.00 26.56           C
ATOM    722  C   GLN H  92      42.091  74.526  -9.171  1.00 27.20           C
ATOM    723  O   GLN H  92      42.486  75.661  -9.447  1.00 28.04           O
ATOM    724  CB  GLN H  92      42.073  72.601 -10.737  1.00 30.27           C
ATOM    725  CG  GLN H  92      41.660  73.545 -11.861  1.00 28.76           C
ATOM    726  CD  GLN H  92      41.349  72.796 -13.141  1.00 36.01           C
ATOM    727  OE1 GLN H  92      40.187  72.554 -13.466  1.00 42.07           O
ATOM    728  NE2 GLN H  92      42.387  72.400 -13.853  1.00 29.65           N
ATOM    729  N   THR H  93      40.986  74.290  -8.474  1.00 26.87           N
ATOM    730  CA  THR H  93      40.194  75.378  -7.935  1.00 27.15           C
ATOM    731  C   THR H  93      41.003  76.215  -6.925  1.00 24.25           C
ATOM    732  O   THR H  93      40.891  77.439  -6.897  1.00 25.26           O
ATOM    733  CB  THR H  93      38.951  74.806  -7.310  1.00 26.35           C
ATOM    734  OG1 THR H  93      38.204  74.187  -8.356  1.00 29.71           O
ATOM    735  CG2 THR H  93      38.100  75.920  -6.594  1.00 23.99           C
ATOM    736  N   ALA H  94      41.851  75.574  -6.123  1.00 24.44           N
ATOM    737  CA  ALA H  94      42.660  76.324  -5.158  1.00 24.66           C
ATOM    738  C   ALA H  94      43.611  77.227  -5.938  1.00 26.46           C
ATOM    739  O   ALA H  94      43.841  78.404  -5.573  1.00 22.63           O
ATOM    740  CB  ALA H  94      43.441  75.364  -4.253  1.00 25.10           C
ATOM    741  N   VAL H  95      44.159  76.698  -7.031  1.00 24.91           N
ATOM    742  CA  VAL H  95      45.089  77.490  -7.852  1.00 22.96           C
ATOM    743  C   VAL H  95      44.413  78.721  -8.420  1.00 23.12           C
ATOM    744  O   VAL H  95      44.989  79.818  -8.426  1.00 25.84           O
ATOM    745  CB  VAL H  95      45.685  76.638  -9.024  1.00 25.25           C
ATOM    746  CG1 VAL H  95      46.238  77.544 -10.103  1.00 28.74           C
ATOM    747  CG2 VAL H  95      46.789  75.740  -8.498  1.00 28.31           C
ATOM    748  N   ARG H  96      43.179  78.544  -8.893  1.00 26.83           N
ATOM    749  CA  ARG H  96      42.387  79.626  -9.483  1.00 26.01           C
ATOM    750  C   ARG H  96      42.055  80.714  -8.440  1.00 27.86           C
ATOM    751  O   ARG H  96      42.003  81.889  -8.748  1.00 24.61           O
ATOM    752  CB  ARG H  96      41.083  79.065 -10.070  1.00 32.11           C
ATOM    753  CG  ARG H  96      41.203  78.592 -11.523  1.00 39.69           C
ATOM    754  CD  ARG H  96      39.871  78.080 -12.052  1.00 40.39           C
ATOM    755  NE  ARG H  96      40.029  77.472 -13.367  1.00 46.21           N
ATOM    756  CZ  ARG H  96      39.398  76.370 -13.769  1.00 47.13           C
ATOM    757  NH1 ARG H  96      38.548  75.736 -12.962  1.00 43.23           N
ATOM    758  NH2 ARG H  96      39.635  75.889 -14.982  1.00 49.98           N
ATOM    759  N   LEU H  97      41.852  80.303  -7.203  1.00 26.62           N
ATOM    760  CA  LEU H  97      41.562  81.241  -6.116  1.00 27.19           C
ATOM    761  C   LEU H  97      42.845  81.955  -5.656  1.00 27.66           C
ATOM    762  O   LEU H  97      42.854  83.137  -5.342  1.00 27.27           O
ATOM    763  CB  LEU H  97      40.978  80.441  -4.942  1.00 21.15           C
ATOM    764  CG  LEU H  97      39.565  79.882  -5.072  1.00 25.53           C
ATOM    765  CD1 LEU H  97      39.298  78.888  -3.931  1.00 23.28           C
ATOM    766  CD2 LEU H  97      38.557  81.053  -4.999  1.00 23.74           C
ATOM    767  N   LEU H  98      43.949  81.231  -5.623  1.00 27.67           N
ATOM    768  CA  LEU H  98      45.187  81.831  -5.111  1.00 30.29           C
ATOM    769  C   LEU H  98      46.041  82.631  -6.068  1.00 29.02           C
ATOM    770  O   LEU H  98      46.653  83.638  -5.689  1.00 29.03           O
ATOM    771  CB  LEU H  98      46.077  80.740  -4.511  1.00 28.87           C
ATOM    772  CG  LEU H  98      47.392  81.236  -3.902  1.00 38.78           C
ATOM    773  CD1 LEU H  98      47.096  81.645  -2.451  1.00 39.94           C
ATOM    774  CD2 LEU H  98      48.476  80.145  -3.935  1.00 37.09           C
ATOM    775  N   LEU H  99      46.127  82.181  -7.310  1.00 27.19           N
ATOM    776  CA  LEU H  99      47.008  82.868  -8.240  1.00 26.27           C
ATOM    777  C   LEU H  99      46.358  83.964  -9.091  1.00 28.74           C
ATOM    778  O   LEU H  99      45.214  83.845  -9.497  1.00 32.16           O
ATOM    779  CB  LEU H  99      47.673  81.846  -9.164  1.00 30.83           C
ATOM    780  CG  LEU H  99      48.428  80.644  -8.579  1.00 30.97           C
ATOM    781  CD1 LEU H  99      49.049  79.877  -9.744  1.00 30.08           C
ATOM    782  CD2 LEU H  99      49.513  81.078  -7.593  1.00 29.23           C
ATOM    783  N   PRO H 100      47.096  85.053  -9.355  1.00 31.44           N
ATOM    784  CA  PRO H 100      46.605  86.173 -10.168  1.00 35.22           C
ATOM    785  C   PRO H 100      46.366  85.711 -11.610  1.00 37.55           C
ATOM    786  O   PRO H 100      47.079  84.855 -12.126  1.00 38.58           O
ATOM    787  CB  PRO H 100      47.763  87.185 -10.113  1.00 33.23           C
ATOM    788  CG  PRO H 100      48.402  86.915  -8.834  1.00 37.00           C
ATOM    789  CD  PRO H 100      48.375  85.402  -8.707  1.00 31.72           C
ATOM    790  N   GLY H 101      45.382  86.321 -12.253  1.00 40.08           N
ATOM    791  CA  GLY H 101      45.025  86.023 -13.630  1.00 40.08           C
ATOM    792  C   GLY H 101      45.843  85.126 -14.542  1.00 39.80           C
ATOM    793  O   GLY H 101      45.566  83.933 -14.660  1.00 40.50           O
ATOM    794  N   GLU H 102      46.830  85.699 -15.221  1.00 40.56           N
ATOM    795  CA  GLU H 102      47.643  84.945 -16.169  1.00 40.16           C
ATOM    796  C   GLU H 102      48.427  83.811 -15.546  1.00 39.68           C
ATOM    797  O   GLU H 102      48.576  82.749 -16.143  1.00 33.31           O
ATOM    798  CB  GLU H 102      48.593  85.879 -16.905  1.00 44.61           C
ATOM    799  CG  GLU H 102      49.177  85.280 -18.164  1.00 51.51           C
ATOM    800  CD  GLU H 102      48.107  84.866 -19.168  1.00 56.19           C
ATOM    801  OE1 GLU H 102      47.133  85.628 -19.375  1.00 55.44           O
ATOM    802  OE2 GLU H 102      48.247  83.778 -19.763  1.00 58.53           O
ATOM    803  N   LEU H 103      48.943  84.042 -14.346  1.00 37.04           N
ATOM    804  CA  LEU H 103      49.682  83.017 -13.641  1.00 37.38           C
ATOM    805  C   LEU H 103      48.770  81.801 -13.431  1.00 34.40           C
ATOM    806  O   LEU H 103      49.196  80.660 -13.606  1.00 33.21           O
ATOM    807  CB  LEU H 103      50.170  83.586 -12.297  1.00 36.86           C
ATOM    808  CG  LEU H 103      51.638  83.506 -11.885  1.00 41.51           C
ATOM    809  CD1 LEU H 103      52.588  83.504 -13.078  1.00 39.33           C
ATOM    810  CD2 LEU H 103      51.924  84.682 -10.957  1.00 38.43           C
ATOM    811  N   ALA H 104      47.511  82.040 -13.061  1.00 32.69           N
ATOM    812  CA  ALA H 104      46.580  80.939 -12.837  1.00 30.83           C
ATOM    813  C   ALA H 104      46.291  80.136 -14.125  1.00 35.22           C
ATOM    814  O   ALA H 104      46.245  78.896 -14.114  1.00 33.67           O
ATOM    815  CB  ALA H 104      45.271  81.471 -12.262  1.00 34.72           C
ATOM    816  N   LYS H 105      46.090  80.843 -15.229  1.00 34.17           N
ATOM    817  CA  LYS H 105      45.790  80.184 -16.499  1.00 34.71           C
ATOM    818  C   LYS H 105      46.900  79.214 -16.888  1.00 32.50           C
ATOM    819  O   LYS H 105      46.629  78.064 -17.207  1.00 31.56           O
ATOM    820  CB  LYS H 105      45.574  81.218 -17.610  1.00 35.98           C
ATOM    821  CG  LYS H 105      45.061  80.598 -18.919  1.00 41.98           C
ATOM    822  CD  LYS H 105      44.618  81.662 -19.929  1.00 46.21           C
ATOM    823  CE  LYS H 105      45.815  82.447 -20.431  1.00 50.21           C
ATOM    824  NZ  LYS H 105      46.834  81.517 -20.994  1.00 52.45           N
ATOM    825  N   HIS H 106      48.143  79.675 -16.859  1.00 31.05           N
ATOM    826  CA  HIS H 106      49.283  78.822 -17.187  1.00 32.91           C
ATOM    827  C   HIS H 106      49.505  77.738 -16.131  1.00 34.34           C
ATOM    828  O   HIS H 106      49.864  76.612 -16.463  1.00 34.24           O
ATOM    829  CB  HIS H 106      50.534  79.668 -17.331  1.00 38.45           C
ATOM    830  CG  HIS H 106      50.495  80.571 -18.514  1.00 42.47           C
ATOM    831  ND1 HIS H 106      51.049  80.227 -19.728  1.00 47.09           N
ATOM    832  CD2 HIS H 106      49.908  81.776 -18.695  1.00 46.66           C
ATOM    833  CE1 HIS H 106      50.802  81.181 -20.606  1.00 48.81           C
ATOM    834  NE2 HIS H 106      50.111  82.133 -20.006  1.00 47.15           N
ATOM    835  N   ALA H 107      49.283  78.058 -14.856  1.00 30.01           N
ATOM    836  CA  ALA H 107      49.456  77.029 -13.840  1.00 30.67           C
ATOM    837  C   ALA H 107      48.436  75.926 -14.102  1.00 31.41           C
ATOM    838  O   ALA H 107      48.757  74.733 -14.039  1.00 33.70           O
ATOM    839  CB  ALA H 107      49.263  77.617 -12.433  1.00 28.10           C
ATOM    840  N   VAL H 108      47.205  76.321 -14.411  1.00 29.66           N
ATOM    841  CA  VAL H 108      46.149  75.354 -14.673  1.00 31.75           C
ATOM    842  C   VAL H 108      46.486  74.514 -15.920  1.00 35.60           C
ATOM    843  O   VAL H 108      46.299  73.298 -15.924  1.00 32.17           O
ATOM    844  CB  VAL H 108      44.797  76.077 -14.826  1.00 32.34           C
ATOM    845  CG1 VAL H 108      43.734  75.170 -15.467  1.00 33.36           C
ATOM    846  CG2 VAL H 108      44.316  76.492 -13.438  1.00 33.70           C
ATOM    847  N   SER H 109      47.008  75.174 -16.951  1.00 36.25           N
ATOM    848  CA  SER H 109      47.391  74.500 -18.192  1.00 38.49           C
ATOM    849  C   SER H 109      48.514  73.485 -17.955  1.00 39.97           C
ATOM    850  O   SER H 109      48.530  72.403 -18.559  1.00 42.83           O
ATOM    851  CB  SER H 109      47.839  75.540 -19.219  1.00 38.31           C
ATOM    852  OG  SER H 109      48.385  74.924 -20.369  1.00 49.80           O
ATOM    853  N   GLU H 110      49.448  73.829 -17.074  1.00 37.88           N
ATOM    854  CA  GLU H 110      50.563  72.946 -16.764  1.00 38.58           C
ATOM    855  C   GLU H 110      50.089  71.776 -15.920  1.00 39.85           C
ATOM    856  O   GLU H 110      50.502  70.639 -16.147  1.00 38.08           O
ATOM    857  CB  GLU H 110      51.662  73.705 -16.017  1.00 39.28           C
ATOM    858  CG  GLU H 110      52.445  74.679 -16.866  1.00 44.80           C
ATOM    859  CD  GLU H 110      53.224  73.976 -17.958  1.00 48.48           C
ATOM    860  OE1 GLU H 110      53.999  73.054 -17.638  1.00 49.73           O
ATOM    861  OE2 GLU H 110      53.059  74.341 -19.136  1.00 54.11           O
ATOM    862  N   GLY H 111      49.215  72.057 -14.949  1.00 39.51           N
ATOM    863  CA  GLY H 111      48.698  71.012 -14.086  1.00 36.90           C
ATOM    864  C   GLY H 111      47.898  69.998 -14.874  1.00 38.79           C
ATOM    865  O   GLY H 111      48.075  68.788 -14.723  1.00 40.27           O
ATOM    866  N   THR H 112      47.010  70.494 -15.719  1.00 39.81           N
ATOM    867  CA  THR H 112      46.174  69.631 -16.540  1.00 44.82           C
ATOM    868  C   THR H 112      47.009  68.765 -17.493  1.00 44.90           C
ATOM    869  O   THR H 112      46.664  67.614 -17.757  1.00 45.65           O
ATOM    870  CB  THR H 112      45.182  70.463 -17.346  1.00 45.63           C
ATOM    871  OG1 THR H 112      44.380  71.220 -16.433  1.00 50.31           O
ATOM    872  CG2 THR H 112      44.272  69.565 -18.183  1.00 47.41           C
ATOM    873  N   LYS H 113      48.106  69.326 -17.982  1.00 42.30           N
ATOM    874  CA  LYS H 113      48.998  68.620 -18.885  1.00 44.50           C
ATOM    875  C   LYS H 113      49.715  67.478 -18.177  1.00 44.76           C
ATOM    876  O   LYS H 113      49.807  66.378 -18.713  1.00 44.49           O
ATOM    877  CB  LYS H 113      50.037  69.578 -19.459  1.00 44.77           C
ATOM    878  CG  LYS H 113      51.125  68.887 -20.272  1.00 47.31           C
ATOM    879  CD  LYS H 113      52.246  69.836 -20.627  1.00 50.33           C
ATOM    880  CE  LYS H 113      51.731  71.044 -21.369  1.00 55.21           C
ATOM    881  NZ  LYS H 113      52.841  71.941 -21.793  1.00 61.22           N
ATOM    882  N   ALA H 114      50.235  67.741 -16.980  1.00 40.47           N
ATOM    883  CA  ALA H 114      50.936  66.714 -16.234  1.00 40.81           C
ATOM    884  C   ALA H 114      50.021  65.554 -15.846  1.00 43.60           C
ATOM    885  O   ALA H 114      50.436  64.384 -15.871  1.00 41.99           O
ATOM    886  CB  ALA H 114      51.590  67.318 -15.004  1.00 40.94           C
ATOM    887  N   VAL H 115      48.777  65.862 -15.489  1.00 43.66           N
ATOM    888  CA  VAL H 115      47.836  64.815 -15.108  1.00 44.73           C
ATOM    889  C   VAL H 115      47.420  63.979 -16.329  1.00 46.71           C
ATOM    890  O   VAL H 115      47.187  62.781 -16.215  1.00 47.31           O
ATOM    891  CB  VAL H 115      46.576  65.411 -14.435  1.00 45.53           C
ATOM    892  CG1 VAL H 115      45.574  64.301 -14.122  1.00 42.91           C
ATOM    893  CG2 VAL H 115      46.980  66.142 -13.142  1.00 43.44           C
ATOM    894  N   THR H 116      47.318  64.613 -17.488  1.00 47.75           N
ATOM    895  CA  THR H 116      46.956  63.899 -18.707  1.00 49.65           C
ATOM    896  C   THR H 116      48.102  62.969 -19.088  1.00 52.62           C
ATOM    897  O   THR H 116      47.901  61.768 -19.263  1.00 54.43           O
ATOM    898  CB  THR H 116      46.682  64.863 -19.858  1.00 50.74           C
ATOM    899  OG1 THR H 116      45.510  65.635 -19.556  1.00 53.05           O
ATOM    900  CG2 THR H 116      46.442  64.092 -21.154  1.00 51.42           C
ATOM    901  N   LYS H 117      49.305  63.524 -19.202  1.00 53.03           N
ATOM    902  CA  LYS H 117      50.480  62.738 -19.533  1.00 55.39           C
ATOM    903  C   LYS H 117      50.524  61.560 -18.557  1.00 57.23           C
ATOM    904  O   LYS H 117      50.407  60.400 -18.959  1.00 58.36           O
ATOM    905  CB  LYS H 117      51.734  63.613 -19.406  1.00 54.75           C
ATOM    906  CG  LYS H 117      53.068  62.874 -19.480  1.00 58.25           C
ATOM    907  CD  LYS H 117      53.429  62.442 -20.889  1.00 59.40           C
ATOM    908  CE  LYS H 117      54.798  61.746 -20.931  1.00 61.35           C
ATOM    909  NZ  LYS H 117      55.923  62.632 -20.503  1.00 60.59           N
ATOM    910  N   TYR H 118      50.666  61.872 -17.272  1.00 54.96           N
ATOM    911  CA  TYR H 118      50.706  60.873 -16.213  1.00 54.68           C
ATOM    912  C   TYR H 118      49.655  59.779 -16.426  1.00 57.11           C
ATOM    913  O   TYR H 118      49.940  58.587 -16.268  1.00 57.35           O
ATOM    914  CB  TYR H 118      50.447  61.554 -14.868  1.00 52.78           C
ATOM    915  CG  TYR H 118      50.432  60.629 -13.677  1.00 48.33           C
ATOM    916  CD1 TYR H 118      51.617  60.198 -13.089  1.00 48.21           C
ATOM    917  CD2 TYR H 118      49.231  60.207 -13.123  1.00 47.57           C
ATOM    918  CE1 TYR H 118      51.600  59.369 -11.970  1.00 50.75           C
ATOM    919  CE2 TYR H 118      49.201  59.384 -12.007  1.00 46.45           C
ATOM    920  CZ  TYR H 118      50.385  58.969 -11.436  1.00 50.06           C
ATOM    921  OH  TYR H 118      50.350  58.153 -10.328  1.00 55.67           O
ATOM    922  N   THR H 119      48.437  60.188 -16.767  1.00 58.01           N
ATOM    923  CA  THR H 119      47.362  59.236 -16.981  1.00 61.74           C
ATOM    924  C   THR H 119      47.687  58.327 -18.158  1.00 64.97           C
ATOM    925  O   THR H 119      47.796  57.116 -17.997  1.00 66.80           O
ATOM    926  CB  THR H 119      46.028  59.948 -17.252  1.00 62.20           C
ATOM    927  OG1 THR H 119      45.620  60.662 -16.080  1.00 65.17           O
ATOM    928  CG2 THR H 119      44.953  58.943 -17.611  1.00 63.79           C
ATOM    929  N   SER H 120      47.843  58.916 -19.341  1.00 67.57           N
ATOM    930  CA  SER H 120      48.161  58.152 -20.541  1.00 69.12           C
ATOM    931  C   SER H 120      49.551  57.543 -20.429  1.00 70.74           C
ATOM    932  O   SER H 120      50.196  57.262 -21.441  1.00 71.38           O
ATOM    933  CB  SER H 120      48.094  59.053 -21.781  1.00 69.17           C
ATOM    934  OG  SER H 120      46.766  59.473 -22.059  1.00 68.16           O
ATOM    935  N   ALA H 121      50.010  57.336 -19.198  1.00 72.55           N
ATOM    936  CA  ALA H 121      51.333  56.771 -18.961  1.00 74.78           C
ATOM    937  C   ALA H 121      51.303  55.359 -18.385  1.00 76.62           C
ATOM    938  O   ALA H 121      50.581  55.079 -17.426  1.00 76.91           O
ATOM    939  CB  ALA H 121      52.123  57.682 -18.043  1.00 74.66           C
ATOM    940  N   LYS H 122      52.104  54.481 -18.983  1.00 78.46           N
ATOM    941  CA  LYS H 122      52.226  53.084 -18.567  1.00 79.87           C
ATOM    942  C   LYS H 122      52.037  52.921 -17.060  1.00 80.93           C
ATOM    943  O   LYS H 122      51.383  51.940 -16.640  1.00 81.92           O
ATOM    944  CB  LYS H 122      53.601  52.549 -18.978  1.00 80.00           C
ATOM    945  CG  LYS H 122      53.935  51.165 -18.448  1.00 80.61           C
ATOM    946  CD  LYS H 122      53.027  50.100 -19.040  1.00 81.74           C
ATOM    947  CE  LYS H 122      53.428  48.713 -18.559  1.00 81.25           C
ATOM    948  NZ  LYS H 122      53.392  48.617 -17.071  1.00 80.48           N
ATOM    949  OXT LYS H 122      52.557  53.776 -16.316  1.00 80.90           O
TER     950      LYS H 122
HETATM  951 CL   CL  H3145      43.057  63.087  -7.903  1.00 36.26          Cl
HETATM  952  O   HOH H3146      74.103  85.672  -2.359  1.00 28.36           O
HETATM  953  O   HOH H3147      29.519  73.653  -1.250  1.00 36.92           O
HETATM  954  O   HOH H3148      60.578  79.525   4.714  1.00 40.13           O
HETATM  955  O   HOH H3149      70.647  76.941  -0.076  1.00 45.67           O
HETATM  956  O   HOH H3150      56.880  71.836   0.598  1.00 48.25           O
HETATM  957  O   HOH H3151      67.992  69.970 -15.872  1.00 59.69           O
HETATM  958  O   HOH H3152      51.888  85.608   1.957  1.00 30.85           O
HETATM  959  O   HOH H3153      58.115  78.895   3.056  1.00 27.58           O
HETATM  960  O   HOH H3154      68.475  83.729   1.671  1.00 38.08           O
HETATM  961  O   HOH H3155      42.971  83.367 -10.694  1.00 37.17           O
HETATM  962  O   HOH H3156      55.465  70.830   2.809  1.00 51.10           O
HETATM  963  O   HOH H3157      44.376  77.477 -18.468  1.00 35.73           O
HETATM  964  O   HOH H3158      40.061  79.887   2.053  1.00 45.84           O
HETATM  965  O   HOH H3159      64.783  79.256   3.222  1.00 35.03           O
HETATM  966  O   HOH H3160      47.601  86.111  -5.986  1.00 42.41           O
HETATM  967  O   HOH H3161      52.871  83.241   3.077  1.00 31.48           O
HETATM  968  O   HOH H3162      42.347  75.742   7.175  1.00 48.35           O
HETATM  969  O   HOH H3163      36.815  65.688  -7.155  1.00 64.61           O
HETATM  970  O   HOH H3164      42.515  61.898 -19.670  1.00 83.60           O
HETATM  971  O   HOH H3165      43.436  68.021 -14.703  1.00 61.32           O
HETATM  972  O   HOH H3166      43.502  88.061 -11.928  1.00 57.24           O
HETATM  973  O   HOH H3167      69.625  70.327  -1.207  1.00 60.23           O
HETATM  974  O   HOH H3168      68.135  70.516   3.338  1.00 57.36           O
HETATM  975  O   HOH H3169      60.115  69.304   2.068  1.00 54.16           O
HETATM  976  O   HOH H3170      45.303  73.235   6.039  1.00 46.54           O
HETATM  977  O   HOH H3171      61.988  69.458   4.926  1.00 65.58           O
HETATM  978  O   HOH H3172      43.398  75.102 -19.335  1.00 62.29           O
HETATM  979  O   HOH H3173      45.745  79.355   1.268  1.00 41.93           O
HETATM  980  O   HOH H3174      70.311  86.889   3.897  1.00 45.76           O
HETATM  981  O   HOH H3175      68.247  80.664 -22.516  1.00 73.03           O
HETATM  982  O   HOH H3176      66.805  76.417   2.695  1.00 55.54           O
HETATM  983  O   HOH H3177      48.560  83.368   2.736  1.00 66.37           O
HETATM  984  O   HOH H3178      47.504  82.705   0.600  1.00 41.30           O
HETATM  985  O   HOH H3179      77.316  82.895 -20.292  1.00 66.01           O
HETATM  986  O   HOH H3180      68.513  73.550   0.546  1.00 65.29           O
HETATM  987  O   HOH H3181      72.083  69.585  -7.812  1.00 71.61           O
HETATM  988  O   HOH H3182      63.195  76.967   3.094  1.00 69.19           O
HETATM  989  O   HOH H3183      69.695  68.970  -9.757  1.00 46.30           O
HETATM  990  O   HOH H3184      39.619  77.688  -0.450  1.00 30.53           O
HETATM  991  O   HOH H3185      62.352  71.972   2.707  1.00 52.08           O
HETATM  992  O   HOH H3186      71.128  84.529 -16.966  1.00 52.08           O
HETATM  993  O   HOH H3187      42.322  85.485 -15.284  1.00 69.39           O
HETATM  994  O   HOH H3188      39.884  83.760  -8.201  1.00 67.26           O
HETATM  995  O   HOH H3189      43.669  81.071   6.311  1.00 66.30           O
HETATM  996  O   HOH H3190      25.486  69.896   0.498  1.00 65.36           O
HETATM  997  O   HOH H3191      37.786  75.842 -10.368  1.00 54.73           O
HETATM  998  O   HOH H3192      62.820  59.786  -6.717  1.00 47.62           O
HETATM  999  O   HOH H3193      54.752  72.850   5.094  1.00 69.46           O
HETATM 1000  O   HOH H3194      65.888  77.394 -22.370  1.00 60.54           O
HETATM 1001  O   HOH H3195      38.210  72.798 -10.689  1.00 39.67           O
HETATM 1002  O   HOH H3196      53.180  69.976 -16.679  1.00 42.17           O
HETATM 1003  O   HOH H3197      34.165  60.546   4.263  1.00 67.31           O
HETATM 1004  O   HOH H3198      46.673  77.446   4.628  1.00 54.35           O
HETATM 1005  O   HOH H3199      41.518  79.286 -14.627  1.00 59.69           O
HETATM 1006  O   HOH H3200      30.954  72.700   4.763  1.00 63.16           O
HETATM 1007  O   HOH H3201      50.681  82.438   4.657  1.00 49.82           O
HETATM 1008  O   HOH H3202      50.047  79.717   4.746  1.00 52.31           O
HETATM 1009  O   HOH H3203      42.354  78.158 -17.675  1.00 45.32           O
HETATM 1010  O   HOH H3204      63.676  65.279 -10.833  1.00 48.19           O
HETATM 1011  O   HOH H3205      76.409  75.347  -2.889  1.00 70.09           O
HETATM 1012  O   HOH H3206      40.493  81.491   4.128  1.00 54.21           O
HETATM 1013  O   HOH H3207      35.764  67.125   5.706  1.00 53.03           O
HETATM 1014  O   HOH H3208      60.615  77.209   4.325  1.00 44.42           O
HETATM 1015  O   HOH H3209      26.610  71.765   1.830  1.00 65.77           O
HETATM 1016  O   HOH H3210      54.229  75.014 -21.398  1.00 55.21           O
HETATM 1017  O   HOH H3211      70.475  68.403 -12.233  1.00 63.54           O
HETATM 1018  O   HOH H3212      45.114  60.996 -20.724  1.00 71.80           O
HETATM 1019  O   HOH H3213      40.046  62.018 -11.440  1.00 73.87           O
HETATM 1020  O   HOH H3214      74.164  76.933  -4.769  1.00 72.07           O
HETATM 1021  O   HOH H3215      47.242  71.872 -21.091  1.00 51.36           O
HETATM 1022  O   HOH H3216      52.301  77.607 -19.735  1.00 56.86           O
HETATM 1023  O   HOH H3217      41.494  72.939   6.164  1.00 46.00           O
HETATM 1024  O   HOH H3218      72.224  75.756  -1.572  1.00 53.53           O
HETATM 1025  O   HOH H3219      68.083  76.162   0.405  1.00 52.55           O
HETATM 1026  O   HOH H3220      38.143  70.871 -14.996  1.00 73.51           O
HETATM 1027  O   HOH H3221      76.757  82.886   0.967  1.00 81.60           O
HETATM 1028  O   HOH H3222      45.489  87.246  -6.512  1.00 56.88           O
HETATM 1029  O   HOH H3223      45.709  55.966 -16.640  1.00 70.67           O
HETATM 1030  O   HOH H3224      45.123  81.658   3.979  1.00 56.49           O
HETATM 1031  O   HOH H3225      41.981  81.815 -13.392  1.00 52.00           O
HETATM 1032  O   HOH H3226      42.285  72.349 -17.123  1.00 58.07           O
HETATM 1033  O   HOH H3227      48.236  56.485 -10.113  1.00 80.26           O
HETATM 1034  O   HOH H3228      27.490  66.358  -3.591  1.00 71.87           O
HETATM 1035  O   HOH H3229      73.016  75.713 -23.578  1.00 71.38           O
HETATM 1036  O   HOH H3230      33.230  67.328   6.312  1.00 80.91           O
HETATM 1037  O   HOH H3231      77.379  81.180   8.126  1.00 74.46           O
HETATM 1038  O   HOH H3232      66.570  72.493   4.153  1.00 57.70           O
HETATM 1039  O   HOH H3233      58.557  70.900   3.428  1.00 74.22           O
HETATM 1040  O   HOH H3234      49.728  53.587 -10.203  1.00 71.06           O
HETATM 1041  O   HOH H3235      63.202  62.351   0.085  1.00 49.55           O
HETATM 1042  O   HOH H3236      52.284  55.743 -21.631  1.00 79.82           O
HETATM 1043  O   HOH H3237      42.658  79.254 -21.302  1.00 85.50           O
HETATM 1044  O   HOH H3238      76.862  79.967 -14.610  1.00 58.85           O
HETATM 1045  O   HOH H3239      47.555  56.248 -13.065  1.00 74.29           O
HETATM 1046  O   HOH H3240      75.328  83.781   6.948  1.00 72.89           O
HETATM 1047  O   HOH H3241      60.967  84.433  -4.097  1.00 61.68           O
HETATM 1048  O   HOH H3242      38.887  60.534  -9.248  1.00 74.11           O
HETATM 1049  O   HOH H3243      46.475  69.640 -21.782  1.00 50.82           O
HETATM 1050  O   HOH H3244      33.061  72.018 -11.790  1.00 68.03           O
HETATM 1051  O   HOH H3245      67.612  53.481  12.412  1.00 81.94           O
HETATM 1052  O   HOH H3246      71.193  73.459 -22.842  1.00 79.71           O
HETATM 1053  O   HOH H3247      51.528  48.357 -14.958  1.00 61.39           O
HETATM 1054  O   HOH H3248      57.333  76.481   6.776  1.00 87.37           O
HETATM 1055  O   HOH H3249      37.117  76.609 -17.075  1.00 89.61           O
HETATM 1056  O   HOH H3250      58.524  63.644 -20.691  1.00 67.28           O
HETATM 1057  O   HOH H3251      41.516  76.410 -21.402  1.00 75.53           O
HETATM 1058  O   HOH H3252      46.486  80.410 -24.233  1.00 68.07           O
HETATM 1059  O   HOH H3253      56.308  73.117 -21.658  1.00 68.40           O
HETATM 1060  O   HOH H3254      60.771  72.122   4.728  1.00 66.91           O
HETATM 1061  O   HOH H3255      28.923  70.395  -2.395  1.00 55.33           O
HETATM 1062  O   HOH H3256      74.364  72.568 -16.384  1.00 72.57           O
HETATM 1063  O   HOH H3257      30.249  64.097   6.156  1.00 73.35           O
HETATM 1064  O   HOH H3258      44.267  65.709 -23.410  1.00 52.48           O
HETATM 1065  O   HOH H3259      77.772  81.403 -17.616  1.00 68.10           O
HETATM 1066  O   HOH H3260      43.181  84.542 -17.644  1.00 67.87           O
HETATM 1067  O   HOH H3261      69.174  72.693   4.068  1.00 72.38           O
HETATM 1068  O   HOH H3262      48.214  67.410 -22.665  1.00 58.75           O
HETATM 1069  O   HOH H3263      49.546  85.696   2.787  1.00 52.60           O
HETATM 1070  O   HOH H3264      74.390  59.269   5.697  1.00 64.08           O
HETATM 1071  O   HOH H3265      77.054  60.606  12.150  1.00 57.37           O
HETATM 1072  O   HOH H3266      74.352  74.185 -21.628  1.00 62.12           O
HETATM 1073  O   HOH H3267      70.527  69.917 -14.204  1.00 56.45           O
HETATM 1074  O   HOH H3268      48.459  75.821   4.509  1.00 41.10           O
HETATM 1075  O   HOH H3269      43.277  83.005 -15.502  1.00 56.77           O
HETATM 1076  O   HOH H3270      37.859  67.040   4.166  1.00 51.97           O
HETATM 1077  O   HOH H3271      65.931  71.080 -20.435  1.00 60.05           O
HETATM 1078  O   HOH H3272      44.770  67.938 -21.096  1.00 73.49           O
HETATM 1079  O   HOH H3273      44.934  86.476 -18.258  1.00 68.99           O
HETATM 1080  O   HOH H3274      69.273  72.283 -20.404  1.00 74.80           O
HETATM 1081  O   HOH H3275      62.393  63.386  -9.452  1.00 88.76           O
HETATM 1082  O   HOH H3276      28.037  69.557  -0.033  1.00 61.69           O
HETATM 1083  O   HOH H3277      71.912  75.462  -3.949  1.00 55.68           O
HETATM 1084  O   HOH H3278      45.906  75.706   6.397  1.00 59.58           O
HETATM 1085  O   HOH H3279      42.141  81.033   1.871  1.00 54.28           O
HETATM 1086  O   HOH H3280      56.054  72.425   7.449  1.00 54.31           O
HETATM 1087  O   HOH H3281      64.320  79.159 -26.201  1.00 90.52           O
HETATM 1088  O   HOH H3282      41.726  65.578 -14.514  1.00 76.37           O
HETATM 1089  O   HOH H3283      68.157  76.092 -24.144  1.00 81.31           O
HETATM 1090  O   HOH H3284      75.567  76.119 -12.843  1.00 80.23           O
HETATM 1091  O   HOH H3285      42.109  86.439 -20.351  1.00 60.23           O
HETATM 1092  O   HOH H3286      66.818  50.833   8.562  1.00 67.47           O
HETATM 1093  O   HOH H3287      82.534  53.461   8.052  1.00 78.54           O
HETATM 1094  O   HOH H3288      48.934  52.213 -15.068  1.00 81.63           O
HETATM 1095  O   HOH H3289      65.913  68.640 -17.098  1.00 76.70           O
HETATM 1096  O   HOH H3290      37.368  64.132  -9.092  1.00 68.99           O
HETATM 1097  O   HOH H3291      40.317  74.006 -17.423  1.00 70.18           O
HETATM 1098  O   HOH H3292      76.263  81.720 -22.338  1.00 68.19           O
HETATM 1099  O   HOH H3293      42.116  83.559 -20.382  1.00 73.35           O
HETATM 1100  O   HOH H3294      81.097  51.481   7.862  1.00 85.77           O
HETATM 1101  O   HOH H3295      68.391  51.017  10.792  1.00 68.62           O
HETATM 1102  O   HOH H3296      38.198  72.810 -16.559  1.00 76.34           O
HETATM 1103  O   HOH H3297      62.303  69.165   8.228  1.00 77.53           O
HETATM 1104  O   HOH H3298      76.443  74.000 -19.233  1.00 79.56           O
HETATM 1105  O   HOH H3299      69.354  51.758  13.171  1.00 79.20           O
HETATM 1106  O   HOH H3300      82.295  55.711  10.384  1.00 70.48           O
HETATM 1107  O   HOH H3301      40.926  63.688 -16.471  1.00 80.07           O
HETATM 1108  O   HOH H3302      28.596  63.909   2.345  1.00 66.80           O
HETATM 1109  O   HOH H3303      53.840  49.468 -14.585  1.00 67.96           O
HETATM 1110  O   HOH H3304      43.155  85.036  -8.056  1.00 50.92           O
HETATM 1111  O   HOH H3305      48.606  61.870 -23.696  1.00 84.17           O
HETATM 1112  O   HOH H3306      42.245  58.899 -19.869  1.00 75.02           O
HETATM 1113  O   HOH H3307      52.600  79.436   3.605  1.00 34.79           O
HETATM 1114  O   HOH H3308      77.416  83.831 -23.070  1.00 79.72           O
HETATM 1115  O   HOH H3309      56.052  49.191 -15.673  1.00 71.39           O
HETATM 1116  O   HOH H3310      69.709  82.069 -20.747  1.00 49.95           O
HETATM 1117  O   HOH H3311      42.746  55.632 -18.642  1.00 78.65           O
HETATM 1118  O   HOH H3312      60.128  69.416 -18.475  1.00 80.58           O
HETATM 1119  O   HOH H3313      48.213  78.821 -20.572  1.00 66.97           O
HETATM 1120  O   HOH H3314      74.738  82.541  -1.085  1.00 49.39           O
HETATM 1121  O   HOH H3315      38.003  65.379 -11.314  1.00 69.64           O
HETATM 1122  O   HOH H3316      42.843  63.589 -11.324  1.00 51.47           O
HETATM 1123  O   HOH H3317      63.578  62.866  -6.676  1.00 62.52           O
HETATM 1124  O   HOH H3318      55.262  73.576   2.776  1.00 61.68           O
HETATM 1125  O   HOH H3319      40.231  60.684 -22.859  1.00 88.81           O
HETATM 1126  O   HOH H3320      82.250  60.617  10.002  1.00 74.46           O
HETATM 1127  O   HOH H3321      54.355  73.128 -23.694  1.00 76.69           O
HETATM 1128  O   HOH H3322      71.874  80.983 -19.567  1.00 44.64           O
HETATM 1129  O   HOH H3323      73.131  70.239 -14.670  1.00 71.40           O
HETATM 1130  O   HOH H3324      75.012  61.385   8.122  1.00 84.37           O
END



If you find results from this site helpful for your research, please cite one of our papers:

elNémo is maintained by Yves-Henri Sanejouand.
It was developed by Karsten Suhre.
Between 2003 and 2014, it was hosted by IGS (Marseille).
Last modification: October 18th, 2018.